The PDZ-binding domain is essential for the dendritic targeting of 5-HT2A serotonin receptors in cortical pyramidal neurons in vitro

doi:10.1016/S0306-4522(03)00589-X

Neuroscience

Volume 122, Issue 4, 2003, Pages 907-920

https://doi.org/10.1016/S0306-4522(03)00589-X Get rights and content

Abstract

The 5-HT_2A serotonin receptor represents an important molecular target for atypical antipsychotic drugs and for most hallucinogens. In the mammalian cerebral cortex, 5-HT_2A receptors are enriched in pyramidal neurons, within which 5-HT_2A receptors are preferentially sorted to the apical dendrites. In primary cortical cultures, 5-HT_2A receptors are sorted to dendrites and not found in the axons of pyramidal neurons. We identified a sorting motif that mediates the preferential targeting of 5-HT_2A receptors to the dendrites of cortical pyramidal neurons in vitro. We constructed green fluorescent protein-tagged 5-HT_2A receptors wherein potential sorting motifs were disrupted, and subsequently employed either the Semliki Forest virus or calcium phosphate for the transient expression of recombinant 5-HT_2A receptors in cultured cortical pyramidal neurons. Using dual-labeling immunofluorescent confocal microscopy, we quantified the axonal and dendritic sorting patterns of endogenous and recombinant 5-HT_2A receptors. We discovered that disruption of the PDZ-binding domain of the 5-HT_2A receptor greatly attenuates the dendritic targeting of 5-HT_2A receptors without inappropriately sorting 5-HT_2A receptors to axons. The PDZ-binding domain is therefore a necessary signal for the preferential targeting of the 5-HT_2A receptor to the dendritic compartment of cultured cortical pyramidal neurons, the first such role ascribed to this protein–protein interaction motif of any G protein-coupled receptor.

Section snippets

DNA constructs

5-HT_2A-Δ CT was constructed as a truncation mutant of the rat 5-HT_2A receptor with a premature stop codon at amino acid 453. The construction of 5-HT_2A-Δ CT-green fluorescent protein (GFP)-CT was a multi-step process: (1) amplification of 5-HT_2A-Δ CT-BamH1 by PCR (5′-primer: AAAGCGGCCGCGCCACCATGGAAATTCTTTGTGAAGACAAT, 3′-primer: AAAGGATCCCTGTTGTTTCCCCAGTGT), (2) amplification of BamHI-GFP-HindIII from the GFP coding sequence of EGFP-C2 vector (BD Biosciences Clontech, Palo Alto, CA, USA) by PCR

Results

In the mammalian cerebral cortex, 5-HT_2A receptors are abundant in pyramidal neurons, but are also found to a lesser extent in interneurons Willins et al., 1997, Jakab and Goldman-Rakic, 1998, Cornea-Hebert et al., 1999, Cornea-Hebert et al., 2002, Miner et al., 2003. In primary cultures prepared from dissociated frontal cortices of E17–18 rats, the majority of the cells were MAP2-immunoreactive pyramidal neurons, while the remainder comprised GAD65/67-immunoreactive GABAergic interneurons,

Discussion

The major finding of this paper is that the PDZ-binding domain is a necessary dendritic targeting signal for 5-HT_2A receptors in cortical pyramidal neurons in vitro. To our knowledge, this represents the first demonstration of the PDZ-binding domain in mediating the selective sorting of a GPCR to dendrites. The PDZ-binding domain, however, is not involved in excluding 5-HT_2A receptors from axons. The present work supports a mechanism of dendritic targeting in neurons whereby the protein sorting

References (59)

G.K. Aghajanian et al.
Serotonin induces excitatory postsynaptic potentials in apical dendrites of neocortical pyramidal cells
Neuropharmacology
(1997)
G.K. Aghajanian et al.
Serotonin, via 5-HT2A receptors, increases EPSCs in layer V pyramidal cells of prefrontal cortex by an asynchronous mode of glutamate release
Brain Res
(1999)
A. Bhatnagar et al.
The dynamin-dependent, arrestin-independent internalization of 5- hydroxytryptamine 2A (5-HT2A) serotonin receptors reveals differential sorting of arrestins and 5-HT2A receptors during endocytosis
J Biol Chem
(2001)
H. Boudin et al.
Molecular determinants for PICK1 synaptic aggregation and mGluR7a receptor coclusteringrole of the PDZ, coiled-coil, and acidic domains
J Biol Chem
(2001)
H. Boudin et al.
Presynaptic clustering of mGluR7a requires the PICK1 PDZ domain binding site
Neuron
(2000)
M.A. Burack et al.
The role of selective transport in neuronal protein sorting
Neuron
(2000)
A. Caceres et al.
MAP2 is localized to the dendrites of hippocampal neurons which develop in culture
Brain Res
(1984)
J. Choi et al.
Phosphorylation of stargazin by protein kinase A regulates its interaction with PSD-95
J Biol Chem
(2002)
J.J. Chung et al.
Functional diversity of protein C-terminimore than zipcoding?
Trends Cell Biol
(2002)
D.R. Colman
Neuronal polarity and the epithelial metaphor
Neuron
(1999)

A. Blichenberg et al.

Identification of a cis-acting dendritic targeting element in MAP2 mRNAs

J Neurosci

(1999)

Cited by (60)

Transgenic mice encoding modern imaging probes: Properties and applications
2022, Cell Reports
Modern biology is increasingly reliant on optical technologies, including visualization and longitudinal monitoring of cellular processes. The major limitation here is the availability of animal models to track the molecules and cells in their natural environment in vivo. Owing to the integrity of the studied tissue and the high stability of transgene expression throughout life, transgenic mice encoding fluorescent proteins and biosensors represent unique tools for in vivo studies in norm and pathology. We review the strategies for targeting probe expression in specific tissues, cell subtypes, or cellular compartments. We describe the application of transgenic mice expressing fluorescent proteins for tracking protein expression patterns, apoptotic events, tissue differentiation and regeneration, neurogenesis, tumorigenesis, and cell fate mapping. We overview the possibilities of functional imaging of secondary messengers, neurotransmitters, and ion fluxes. Finally, we provide the rationale and perspectives for the use of transgenic imaging probes in translational research and drug discovery.
Pharmacotherapy with sertraline rescues brain development and behavior in a mouse model of CDKL5 deficiency disorder
2020, Neuropharmacology
Mutations in the X-linked cyclin-dependent kinase-like 5 (CDKL5) gene cause a severe neurodevelopmental disorder, CDKL5 deficiency disorder (CDD). CDKL5 is fundamental for correct brain development and function, but the molecular mechanisms underlying aberrant neurologic dysfunction in CDD are incompletely understood. Here we show a dysregulation of hippocampal and cortical serotonergic (5-HT) receptor expression in heterozygous Cdkl5 knockout (KO) female mice, suggesting that impaired 5-HT neurotransmission contributes to CDD. We demonstrate that targeting impaired 5-HT signaling via the selective serotonin reuptake inhibitor (SSRI) sertraline rescues CDD-related neurodevelopmental and behavioral defects in heterozygous Cdkl5 KO female mice. In particular, chronic treatment with sertraline normalized locomotion, stereotypic and autistic-like features, and spatial memory in Cdkl5 KO mice. These positive behavioral effects were accompanied by restored neuronal survival, dendritic development and synaptic connectivity. At a molecular level, sertraline increased brain-derived neurotrophic factor (BDNF) expression and restored abnormal phosphorylation levels of tyrosine kinase B (TrkB) and its downstream target the extracellular signal-regulated kinase (ERK1/2). Since sertraline is an FDA-approved drug with an extensive safety and tolerability data package, even for children, our findings suggest that sertraline may improve neurodevelopment in children with CDD.
This article is part of the special issue entitled ‘Serotonin Research: Crossing Scales and Boundaries’.
Classification and signaling characteristics of 5-HT receptors: toward the concept of 5-HT receptosomes
2020, Handbook of Behavioral Neuroscience
Serotonin (5-hydroxytryptamine, 5-HT) is one of the extracellular messengers capable of activating the largest number of receptors (17 receptors belonging to seven classes—5-HT_1-7—defined first on a pharmacological basis and then on their gene sequence). Alternative splicing and RNA editing add to this diversity. Most 5-HT receptors belong to the G protein–coupled receptor (GPCR) family except for 5-HT₃ receptors that are ionic channels. Their activation gives rise to a huge complexity of intracellular signaling events that depend or not on G protein activation and underlie the diversity of physiological functions of 5-HT. Assembly of 5-HT receptors into heteromers with distinct 5-HT receptors or other GPCRs, as well as their physical association with protein partners further increase the versatility of serotonergic signaling and the complexity of its regulation. These interactions also offer novel opportunities for therapeutic interventions in disorders related to dysfunctions of serotonergic systems.
Serotonin neurobiology in cocaine use disorder
2020, Handbook of Behavioral Neuroscience
Citation Excerpt :
Intriguingly, PSD95 regulates the trafficking of 5-HT2CR in an opposite manner than 5-HT2AR, promoting both constitutive and agonist-induced receptor internalization of the 5-HT2CR (Gavarini et al., 2006). Thus, despite the fact that the 5-HT2AR and 5-HT2CR share a great degree of homology (Bockaert et al., 2006; Hoyer et al., 2002), the regulation of these receptors is differentially and profoundly regulated by PSD95 (Abbas et al., 2009; Becamel et al., 2004; Xia et al., 2003). Initial analyses of PSD95 and 5-HT2AR and 5-HT2CR interactions in mPFC have been undertaken in outbred rats identified with high impulsive and low impulsive phenotypes on the 1-choice serial reaction time (1-CSRT) task.
Cocaine misuse can escalate, leading to compulsive drug-taking and drug-seeking which characterizes the development of cocaine use disorder (CUD), an acquired brain disorder with clinically significant impairment. Cocaine binds to the serotonin (5-hydroxytryptamine; 5-HT) transporter, inhibits reuptake, and increases extracellular 5-HT efflux within limbic-corticostriatal circuitry involved in CUD neurobiology. The role of 5-HT in the in vivo effects of cocaine depends upon the 5-HT receptors and downstream signaling webs triggered. Multiple 5-HT receptor mechanisms and perturbations in the balance of serotonergic control contribute to basal states of vulnerability to CUD processes as well as the altered neurobiological states that drive the transition toward CUD and promote relapse. This review emphasizes the role of 5-HT and its receptor proteins and the implications of current findings to the future of therapeutics to enhance recovery and extend abstinence from CUD.
New therapeutic opportunities for 5-HT<inf>2</inf> receptor ligands
2017, Pharmacology and Therapeutics
Serotonergic dysfunction is mainly associated with neuropsychiatric and cardiovascular disorders but has also been linked with many other pathological conditions. Serotonin (5-hydroxytryptamine, 5-HT) mediates numerous physiological functions in the brain and the periphery by activating a variety of receptors. 5-HT receptors are divided into four classes, three of which belong to the G protein-coupled receptor family. This review provides an overview of the recent pharmacological developments involving the Gq-coupled 5-HT₂ receptor subfamily as well as the pathological implications of this receptor subfamily with regard to fibrosis, the central nervous system, cardiovascular disorders, and cancer. The final section highlights new therapeutic opportunities and emerging research revealing unexplored medical opportunities for this class of 5-HT receptors. The development of biased 5-HT₂ receptor ligands appears to be an interesting topic in various areas. In light of recent discoveries, the need for the development of new and safer drugs should take into account the risk of cardiovascular side effects such as pulmonary hypertension and heart valve disease.
Recombinase-Dependent Mouse Lines for Chemogenetic Activation of Genetically Defined Cell Types
2016, Cell Reports
Citation Excerpt :
In RC::FL-hM3Dq, an FRT-flanked transcriptional stop cassette (Sauer, 1993) following the CAG promoter prevents transcription of all downstream sequence until it is excised by Flp recombinase. The allele also encodes EGFP and an hM3Dq-mCherry fusion protein with a C-terminal epitope (2ACT88) that mediates localization of the hM3Dq receptor to the cell body (soma) and dendrites (Xia et al., 2003). To prevent expression in the absence of Cre recombination, the hM3Dq-mCherry cDNA is inverted in a Cre-dependent FLEx switch consisting of two pairs of antiparallel lox sites (Atasoy et al., 2008; Schnütgen et al., 2003).
Chemogenetic technologies, including the mutated human G_q-coupled M3 muscarinic receptor (hM3Dq), have greatly facilitated our ability to directly link changes in cellular activity to altered physiology and behavior. Here, we extend the hM3Dq toolkit with recombinase-responsive mouse lines that permit hM3Dq expression in virtually any cell type. These alleles encode a fusion protein designed to increase effective expression levels by concentrating hM3Dq to the cell body and dendrites. To illustrate their broad utility, we targeted three different genetically defined cell populations: noradrenergic neurons of the compact, bilateral locus coeruleus and two dispersed populations, Camk2a+ neurons and GFAP+ glia. In all three populations, we observed reproducible expression and confirmed that activation of hM3Dq is sufficient to dose-dependently evoke phenotypic changes, without extreme phenotypes associated with hM3Dq overexpression. These alleles offer the ability to non-invasively control activity of diverse cell types to uncover their function and dysfunction at any developmental stage.

View all citing articles on Scopus

View full text

The PDZ-binding domain is essential for the dendritic targeting of 5-HT2A serotonin receptors in cortical pyramidal neurons in vitro

Abstract

Section snippets

DNA constructs

Results

Discussion

Neuropharmacology

Brain Res

J Biol Chem

J Biol Chem

Neuron

Neuron

Brain Res

J Biol Chem

Trends Cell Biol

Neuron

Neuroscience

Cell

Brain Res Bull

Neuron

Life Sci

J Biol Chem

Neuron

FEBS Lett

Neuropsychopharmacology

Neuron

Neuroscience

Trends Pharmacol Sci

Neuron

Neuroscience

Neuron

Brain Res

Light and electron microscopic studies of the distribution of microtubule-associated protein 2 in rat braina difference between dendritic and axonal cytoskeletons

J Comp Neurol

Rapid agonist-induced internalization of the 5-hydroxytryptamine2A receptor occurs via the endosome pathway in vitro

Mol Pharmacol

Identification of a cis-acting dendritic targeting element in MAP2 mRNAs

J Neurosci

The PDZ-binding domain is essential for the dendritic targeting of 5-HT_2A serotonin receptors in cortical pyramidal neurons in vitro