|
|
|
|
Vol. 60, Issue 6, 1210-1225, December 2001
Departments of Pharmacology and Toxicology (M.T.K., K.W.-S., R.S.) and Molecular Biosciences (T.B.), the University of Kansas, Lawrence, Kansas; and Department of Pharmacy, University of Regensburg, Regensburg, Germany (S.D., A.B.)
| |
Abstract |
|---|
|
|
|---|
It is unknown why the potencies and efficacies of long-chained
guanidine-type histamine H2-receptor (H2R)
agonists are lower at the H2R of human neutrophils than at
the H2R of the guinea pig atrium. To elucidate these
differences, we analyzed fusion proteins of the human H2R
(hH2R) and guinea pig H2R (gpH2R),
respectively, and the short splice variant of Gs
(Gs
S) expressed in Sf9 cells. The potencies and
efficacies of small H2R agonists in the GTPase assay and
the potencies of antagonists at inhibiting histamine-stimulated GTP
hydrolysis by hH2R-Gs
S and
gpH2R-Gs
S were similar. In contrast, the
potencies and efficacies of guanidines were lower at
hH2R-Gs
S than at
gpH2R-Gs
S. Guanidines bound to
hH2R-Gs
S with lower affinity than to
gpH2R-Gs
S, and high-affinity binding of
guanidines at gpH2R-Gs
S was more resistant
to disruption by GTP
S than binding at
hH2R-Gs
S. Molecular modeling suggested that
the nonconserved Asp-271 in transmembrane domain 7 of gpH2R
(Ala-271 in hH2R) confers high potency to guanidines. This
hypothesis was confirmed by Ala-271
Asp-271 mutation in
hH2R-Gs
S. Intriguingly, the efficacies of
guanidines at the Ala-271
Asp-271 mutant and at
hH2R/gpH2R chimeras were lower than at
gpH2R. Our model suggests that a Tyr-17/Asp-271 H-bond,
present only in gpH2R-Gs
S but not the other
constructs studied, stabilizes the active guanidine-H2R
state. Collectively, our data show 1) distinct interaction of
H2R species isoforms with guanidines, 2) that a single
amino acid in transmembrane domain 7 critically determines guanidine
potency, and 3) that an interaction between transmembrane domains 1 and
7 is important for guanidine efficacy.
| |
Introduction |
|---|
|
|
|---|
HIS
(1) is a biogenic amine (Fig.
1) that functions as a neurotransmitter
and autacoid (Hill et al., 1997
). HIS exerts its effects through at
least four receptor subtypes, designated H1,
H2, H3, and
H4, respectively (Hill et al., 1997
; Hough,
2001
). HIS receptors belong to the superfamily of GPCRs that possess seven transmembrane domains, three extracellular and three
intracellular loops. The H2R couples to
Gs-proteins to activate adenylyl cyclase. Numerous H2R agonists and antagonists have been
developed; the guinea pig atrium has been the standard model for ligand
design for decades (Ganellin, 1982
; Hill et al., 1997
). Figure 1 shows the structures of prototypical H2R agonists and
antagonists. Among agonists, DIM (2), AMT (3),
and BET (4) are similar to HIS (1). BET is a
nonselective H2R partial agonist (Ganellin, 1982
;
Burde et al., 1989
) and is therefore an interesting experimental tool.
Compared with compounds 1 to 4, the guanidines
5 to 13 are long-chained and more bulky. IMP
(5), ARP (8), and several ARP analogs are much
more potent in the guinea pig atrium than HIS (Durant et al., 1978
;
Buschauer, 1989
). H2R antagonists are divided
into five chemical classes: imidazoles such as CIM (14),
furans such as RAN (15), thiazoles such as FAM
(16), and TIO (17), piperidinomethylphenoxy
derivatives such as ZOL (18), and
(benzamidoalkyl)cyanoguanidines such as APT (19) (Hill et
al., 1997
). H2R antagonists are of great
importance for the treatment of gastroduodenal ulcer disease (Hill et
al., 1997
). H2R agonists may be useful as
positive inotropic drugs for the treatment of heart failure (Felix et
al., 1995
), as differentiation-inducing agents in acute myelogenous
leukemia (Seifert et al., 1992
), and as anti-inflammatory drugs (Burde
et al., 1990
).
|
Guanidine-type compounds are less potent and/or efficient agonists at
the H2R of human neutrophils than at the
H2R of the guinea pig atrium (Burde et al., 1989
,
1990
; Buschauer, 1989
). Additionally, several GPCR species isoforms,
including the H3R, differ from each other in
their pharmacological properties as assessed by the analysis of
recombinant GPCRs (Kopin et al., 2000
; Ligneau et al., 2000
; Lovenberg
et al., 2000
). There are relatively few amino acid differences between
hH2R and gpH2R (Gantz et
al., 1991
; Traiffort et al., 1995
) (Fig.
2), particularly in the established ligand-binding domains TM3 and TM5, but even a single amino acid exchange between GPCR species isoforms can strongly affect their pharmacological properties (Kopin et al., 2000
; Ligneau et al., 2000
).
Based on these findings, the hypothesis arose that the H2R exhibits species-specific pharmacological
properties as well.
|
To test our hypothesis, we constructed fusion proteins of the
hH2R and gpH2R,
respectively, and Gs
S and expressed the fusion
proteins in Sf9 cell membranes. GPCR-G
fusion
proteins ensure a defined 1:1 stoichiometry of the signaling partners
and efficient coupling (Seifert et al., 1999
; Milligan, 2000
). The measurement of GTP hydrolysis in GPCR-G
fusion
proteins is presumably the most precise method currently available for
the analysis of ligand potencies and efficacies, because the GTPase assay is a steady-state method, is extremely sensitive in
GPCR-Gs
fusion proteins, assesses
GPCR/G-protein coupling directly at the G-protein level, and is
independent of the expression level of the components (Seifert et al.,
1999
; Milligan, 2000
). Finally, the analysis of
H2R species isoforms in the same host cell
membrane annihilates the impact of pharmacokinetic differences between different test systems. Here, we report that hH2R
and gpH2R exhibit distinct pharmacological
properties, particularly with respect to interaction with guanidines.
| |
Experimental Procedures |
|---|
|
|
|---|
Materials.
The cDNA for the hH2R was
kindly provided by Dr. I. Gantz (University of Michigan Medical School
and Ann Arbor VA Medical Center, Ann Arbor, MI) (Gantz et al., 1991
).
The cDNA for the gpH2R was kindly provided by
Drs. E. Traiffort and J.-C. Schwartz (Department of Neurobiology and
Pharmacology, Center Paul Broca, Institut National de la Santé et
de la Recherche Médicale, Paris, France) (Traiffort et al.,
1995
). The generation of the baculovirus encoding
2AR-Gs
L had been
described previously (Seifert et al., 1998a
). APT was synthesized
as described previously (Hirschfeld et al., 1992
). IMP was prepared as
described previously (Durant et al., 1978
). Guanidines 6 to
11 were synthesized as described previously (Buschauer,
1989
). Guanidines 12 and 13 (Schalkhausser, 1998
)
were prepared by analogy to the procedures described for guanidines
6 to 11 (Buschauer, 1989
). The structures of the
synthesized compounds were confirmed by analysis (C, H, N),
1H NMR, and mass spectroscopy spectra. Purity of
compounds was >98% as determined by high-performance liquid
chromatography or capillary electrophoresis (Schuster et al., 1997
).
The anti-FLAG Ig (M1 monoclonal antibody) was from Sigma (St. Louis,
MO). The anti-Gs
Ig (C-terminal) was from
Calbiochem (La Jolla, CA). [
-32P]GTP (6000 Ci/mmol), [35S]GTP
S (1100 Ci/mmol),
[3H]DHA (85-90 Ci/mmol), and
[3H]TIO (90 Ci/mmol) were from PerkinElmer Life
Sciences (Boston, MA). All unlabeled nucleotides were from Roche
(Indianapolis, IN). HIS, BET, CIM, RAN, and FAM were from Sigma. AMT,
TIO, and ZOL were from Tocris Cookson (Ballwin, MO). DIM was from RBI
(Natick, MA). All restriction enzymes and T4 DNA ligase were from New
England Biolabs (Beverly, MA). Cloned Pfu DNA polymerase was
from Stratagene (La Jolla, CA).
Construction of FLAG Epitope- and Hexahistidine-Tagged cDNA for
hH2R-Gs
S.
A DNA sequence encoding the
cleavable signal peptide from influenza hemagglutinin (S) followed by
the FLAG epitope (F), which is recognized by the M1 antibody, was
placed 5' of the start codon of the hH2R to
enhance GPCR expression and allow immunological detection. We also
added a hexahistidine tag to the C terminus of
hH2R to allow future purification and to provide
additional protection against proteolysis (Seifert et al., 1998a
). The
GPCR modifications were generated by sequential overlap-extension PCRs. In PCR 1A, the DNA sequence of the N-terminal portion of the
hH2R was amplified using
CMVneo-hH2R as template. The sense primer annealed with the first 18 bp of the 5'-end of the
hH2R and included the last 18 bp of the SF in its
5'-extension. The antisense primer encoded the sequence
GAGCTGTTGATATCCGGTGCGGAAGTCTCTG to generate a silent
mutation yielding a new EcoRV site. In PCR 1B, the DNA sequence of the C-terminal portion of the hH2R
was amplified using CMVneo-hH2R as template. The
sense primer encoded the sequence TTCCGCACCGGATATCAACAGCTCTTCTGCTGC to generate the new
EcoRV site. The antisense primer encoded the five C-terminal
amino acids of the hH2R, a hexahistidine tag, the
stop codon and an XbaI site. In PCR 2, the products of PCRs
1A and 1B annealed in the region encoding the newly created
EcoRV site. In PCR 2, the sense primer of PCR 1A and the
antisense primer of PCR 1B were used. In this way, a fragment encoding
the signal sequence, the FLAG epitope, hH2R cDNA
with a new EcoRV site and a hexahistidine tag followed by an
XbaI site was obtained. This fragment was digested with NcoI and XbaI and cloned into pGEM-3Z-SF-human
formyl peptide receptor-6His digested with NcoI and
XbaI. In PCR 3A, the C-terminal portion of the
H2R was amplified using
pGEM-3Z-SF-hH2R as template, a sense primer
annealing 5' of the newly created EcoRV site and an
antisense primer annealing with the hexahistidine tag. In PCR 3B, the
sequence of Gs
S was amplified, using
pGEM-3Z-SF-
2AR-Gs
S as
template, a sense primer annealing with the hexahistidine tag and an
antisense primer annealing with the 5 C-terminal amino acids of
Gs
, the stop codon, and an XbaI
site. In PCR 4, the products of PCRs 3A and 3B annealed in the
hexahistidine region, and the sense primer of PCR 3A and the antisense
primer of PCR 3B were used. In this way, a fragment encoding the
C-terminal portion of the hH2R, a hexahistidine
tag, Gs
S, a stop codon and an XbaI
site was created. This fragment was digested with EcoRV and
XbaI and cloned into pGEM-3Z-SFhH2R
digested with EcoRV and XbaI. In this way, the
full-length cDNA for
hH2R-Gs
S was created.
pGEM-3Z-SF-hH2R-Gs
S was
digested with NcoI and XbaI to recover the fusion
protein cDNA and cloned into the baculovirus transfer vector pVL
1392-SF-
2AR-Gi
2
digested with NcoI and XbaI. PCR-generated DNA
sequences were confirmed by extensive restriction enzyme analysis and
enzymatic sequencing.
Construction of FLAG Epitope- and Hexahistidine-Tagged cDNA for
gpH2R-Gs
S.
The strategy for creation of
gpH2R-Gs
S cDNA was
analogous to the strategy for creation of
hH2R-Gs
S cDNA. In PCR 1A, the DNA sequence of the N-terminal portion of
gpH2R was amplified using
pGEM4Z-gpH2R as template. The sense primer
annealed with the first 20 bp of the 5'-end of the
gpH2R and included the last 8 bp of the SF in its
5'-extension. The antisense primer encoded the sequence
CTCATGGGAGTTGTGGCTAGCGAGCCTGCAGCAGAAGAGC to create a silent
mutation yielding a new NheI site. In PCR 1B, the sequence of the C-terminal portion of gpH2R was amplified
using pGEM4Z-gpH2R as template. The sense primer
encoded the sequence
GCTCTTCTGCTGCAGGCTCGCTAGCCACAACTCCCATGAG to create the new
NheI site. The antisense primer encoded the five C-terminal
amino acids of the gpH2R, a hexahistidine tag, the stop codon, and an XbaI site. In PCR 2, the products of
PCRs 1A and 1B annealed in the region encoding the newly created
NheI site. In PCR 2, the sense primer of PCR 1A and the
antisense primer of PCR 1B were used. In this way, a fragment encoding
the signal sequence, the FLAG epitope, gpH2R cDNA
with a new NheI site, and a hexahistidine tag followed by an
XbaI site was obtained. This fragment was digested with
NcoI and XbaI and cloned into pGEM-3Z-SF-human formyl peptide receptor-6His digested with NcoI and
XbaI. In PCR 3A, the C-terminal portion of the
gpH2R was amplified using
pGEM-3Z-SF-gpH2R as template, a sense primer
annealing 5' of the newly created NheI site, and an
antisense primer annealing with the hexahistidine tag. In PCR 3B, the
sequence of Gs
S was amplified, using pGEM-3Z-SF-
2AR-Gs
S as
template, a sense primer annealing with the hexahistidine tag, and an
antisense primer annealing with the 5 C-terminal amino acids of
Gs
, the stop codon, and an XbaI
site. In PCR 4, the products of PCRs 3A and 3B annealed in the
hexahistidine region, and the sense primer of PCR 3A and the antisense
primer of PCR 3B were used. In this way, a fragment encoding the
C-terminal portion of the gpH2R, a hexahistidine tag, Gs
S, a stop codon, and an XbaI
site was created. This fragment was digested with NheI and
XbaI and cloned into pGEM-3Z-SFgpH2R digested with NheI and XbaI. In this way, the
full-length cDNA for
gpH2R-Gs
S was created.
pGEM-3Z-SF-hH2R-Gs
S was
digested with NcoI and XbaI to recover the fusion
protein cDNA and cloned into the baculovirus transfer vector pVL
1392-SF-
2AR-Gi
2 digested with NcoI and XbaI. PCR-generated DNA
sequences were confirmed by extensive restriction enzyme analysis and
enzymatic sequencing.
Construction of the cDNA for
hH2R-A271D-Gs
S.
The Ala-271
Asp-271
exchange in hH2R was generated by sequential
overlap-extension PCRs. In PCR 1A, the DNA sequence of the N-terminal
portion of hH2R was amplified using
pGEM-3Z-SF-hH2R-Gs
S as a
template. The sense primer annealed with the first 18 bp of the 5' end
of hH2R and included the last 18 bp of the SF in its 5' extension. The antisense primer encoded the sequence
CAGAACGATATCTTCTAACACCTCATTGATGGCATC to generate the
Ala-271
Asp-271 exchange and a new EcoRV site at the
position of the mutated amino acid. In PCR 1B, the DNA sequence of the
C-terminal portion of the hH2R and the entire sequence of Gs
s was amplified using
pGEM-3Z-SF-hH2R-Gs
S as a
template. The sense primer encoded the sequence
GTTAGAAGATATCGTTCTGTGGCTGGGCTATGCCAAC to generate the
Ala-271
Asp-271 exchange and a new EcoRV site at the
position of the mutated amino acid. The antisense primer encoded the
five C-terminal amino acids of Gs
, the stop
codon and an XbaI site. In PCR 2, the products of PCR 1A and
1B annealed in the region encoding the newly created Ala-271
Asp-271 exchange and the EcoRV site. In the PCR 2, the sense
primer of PCR 1A and the antisense primer of PCR 1B were used. In this
way, a fragment encoding the entire
hH2R-A271D-Gs
S fusion
protein was created. This fragment was digested with EcoRI
and NcoI and cloned into pGEM-3Z-SF-hH2R-Gs
S
digested with EcoRI and NcoI.
pGEM-3Z-SF-hH2R-A271D-Gs
S was digested with SacI and EcoN I and cloned into
the baculovirus transfer vector pVL
1392-SF-hH2R-Gs
S
digested with SacI and EcoN I. PCR-generated DNA
sequences were confirmed by extensive restriction enzyme analysis and
enzymatic sequencing.
Construction of the cDNAs for
NgpChH2R-Gs
S and
NhCgpH2R-Gs
S.
For construction of
hH2R/gpH2R chimeras, we
took advantage of the KpnI site present at the same position
of the cDNAs of both receptors. KpnI cleaves
hH2R- and gpH2R cDNA in the
center of the second intracellular loop (Fig. 2).
pGEM-3Z-SF-hH2R-Gs
S and
pGEM-3Z-SF-gpH2R-Gs
S
were digested with KpnI and XbaI so that the
C-terminal halves of H2Rs and the fused
Gs
S were cut out. The fragments obtained were
reciprocally cloned back into
pGEM-3Z-SF-hH2R-Gs
S and
pGEM-3Z-SF-gpH2R-Gs
S. As a result of this exchange, we created
pGEM-3Z-SF-NgpChH2R-Gs
S and
pGEM-3Z-SF-NhCgpH2R-Gs
S.
These plasmids were digested with NcoI and XbaI
and cloned into the baculovirus transfer vector pVL
1392-SF-gpH2R-Gs
S
digested with NcoI and XbaI. The chimeric H2R-Gs
S DNA sequences
were confirmed by extensive restriction enzyme analysis.
Generation of Recombinant Baculoviruses, Cell Culture and
Membrane Preparation.
Recombinant baculoviruses encoding the
H2R-Gs
fusion proteins
were generated in Sf9 cells using the BaculoGOLD transfection kit (BD
PharMingen, San Diego, CA) according to the manufacturer's instructions. After initial transfection, high-titer virus stocks were
generated by two sequential virus amplifications. Sf9 cells were
cultured in 250-ml disposable Erlenmeyer flasks at 28°C under rotation at 125 rpm in SF 900 II medium (Invitrogen, Carlsbad, CA) supplemented with 5% (v/v) fetal calf serum (BioWhittaker, Walkersville, MD) and 0.1 mg/ml gentamicin (BioWhittaker). Cells were
maintained at a density of 0.5 to 6.0 × 106
cells/ml. For infection, cells were sedimented by centrifugation and
suspended in fresh medium. Cells were seeded at 3.0 × 106 cells/ml and infected with a 1:100 dilution
of high-titer baculovirus stocks encoding
H2R-Gs
S fusion proteins.
Cells were cultured for 48 h before membrane preparation. Sf9
membranes were prepared as described previously (Seifert et al.,
1998a
), using 1 mM EDTA, 0.2 mM phenylmethylsulfonyl fluoride, 10 µg/ml benzamidine, and 10 µg/ml leupeptin as protease inhibitors.
Membranes were suspended in binding buffer (12.5 mM
MgCl2, 1 mM EDTA and 75 mM Tris/HCl, pH 7.4) and
stored at
80°C until use.
Receptor Ligand Binding Assays.
Membranes were thawed and
sedimented by a 15-min centrifugation at 4°C and 15,000g
to remove residual endogenous guanine nucleotides as much as possible.
Membranes were resuspended in binding buffer (12.5 mM
MgCl2, 1 mM EDTA and 75 mM Tris/HCl, pH 7.4). In
[3H]TIO binding assays, each tube (total
volume, 250 µl) contained 200 to 250 µg of protein. Nonspecific
binding was determined in the presence of
[3H]TIO at various concentrations plus 100 µM
unlabeled TIO. Incubations were conducted for 90 min at 25°C and
shaking at 250 rpm. In saturation binding experiments, tubes contained
1 to 20 nM [3H]TIO plus unlabeled TIO to obtain
final ligand concentrations of up to 300 nM. Competition binding
experiments were carried out in the presence of 10 nM
[3H]TIO and unlabeled ligands at various
concentrations without or with GTP
S (10 µM). Bound
[3H]TIO was separated from free
[3H]TIO by filtration through GF/C filters,
followed by three washes with 2 ml of binding buffer (4°C).
Filter-bound radioactivity was determined by liquid scintillation
counting. The experimental conditions chosen ensured that not more than
5% of the total amount of [3H]TIO added to
binding tubes was bound to filters. The expression level of
2AR-Gs
L was
determined with 10 nM [3H]DHA as radioligand as
described previously (Seifert et al., 1998a
).
[35S]GTP
S Binding Assay.
Membranes were
thawed, sedimented, and suspended as for receptor ligand binding
assays. Reaction mixtures (total volume, 500 µl) contained Sf9
membranes expressing
H2R-Gs
fusion proteins (15 µg of protein/tube) in binding buffer supplemented with 0.05% (w/v) bovine serum albumin, 1 µM GDP, and 1 nM
[35S]GTP
S plus 9 nM unlabeled GTP
S.
Reaction mixtures additionally contained distilled water (basal) and
HIS at a saturating concentration (100 µM). Incubations were
conducted for 90 min at 25°C and shaking at 250 rpm. Bound
[35S]GTP
S was separated from free
[35S]GTP
S by filtration through GF/C
filters, followed by three washes with 2 ml of binding buffer (4°C).
Filter-bound radioactivity was determined by liquid scintillation
counting. The experimental conditions chosen ensured that no more than
10% of the total amount of [35S]GTP
S added
was bound to filters.
Steady-State GTPase Activity Assay.
Membranes were thawed,
sedimented, and resuspended in 10 mM Tris/HCl, pH 7.4. Assay tubes
contained Sf9 membranes expressing H2R-Gs
fusion proteins
(10 µg of protein/tube), 1.0 mM MgCl2, 0.1 mM
EDTA, 0.1 mM ATP, 100 nM GTP, 1 mM adenylyl imidodiphosphate, 5 mM
creatine phosphate, 40 µg of creatine kinase, and 0.2% (w/v) bovine
serum albumin in 50 mM Tris/HCl, pH 7.4, and H2R
ligands at various concentrations. Reaction mixtures (80 µl) were
incubated for 3 min at 25°C before the addition of 20 µl of
[
-32P]GTP (0.2-0.5 µCi/tube). All stock
and work dilutions of [
-32P]GTP were
prepared in 20 mM Tris/HCl, pH 7.4. Reactions were conducted for 20 min
at 25°C. Preliminary studies under basal conditions and with HIS,
IMP, and ARP showed that under these conditions, GTP hydrolysis was
linear. Reactions were terminated by the addition of 900 µl of slurry
consisting of 5% (w/v) activated charcoal and 50 mM
NaH2PO4, pH 2.0. Charcoal
absorbs nucleotides but not Pi. Charcoal-quenched
reaction mixtures were centrifuged for 15 min at room temperature at
15,000g. Seven hundred microliters of the supernatant fluid
of reaction mixtures were removed, and 32Pi was determined by
liquid scintillation counting. Enzyme activities were corrected for
spontaneous degradation of [
-32P]GTP.
Spontaneous [
-32P]GTP degradation was
determined in tubes containing all of the above described components
plus a very high concentration of unlabeled GTP (1 mM) that, by
competition with [
-32P]GTP, prevents
[
-32P]GTP hydrolysis by enzymatic activities
present in Sf9 membranes. Spontaneous
[
-32P]GTP degradation was <1% of the total
amount of radioactivity added using 20 mM Tris/HCl, pH 7.4, as solvent
for [
-32P]GTP. The experimental conditions
chosen ensured that not more than 10% of the total amount of
[
-32P]GTP added was converted to
32Pi.
SDS-PAGE and Immunoblot Analysis.
Membrane proteins were
separated on SDS polyacrylamide gels containing 8% (w/v) acrylamide.
Proteins were then transferred onto Immobilon-P transfer membranes
(Millipore, Bedford, MA). Membranes were reacted with M1 antibody or
anti-Gs
Ig (1:1000 each). Immunoreactive bands
were visualized by sheep anti-mouse IgG (M1 antibody) and donkey
anti-rabbit IgG (anti-Gs
Ig), respectively,
coupled to peroxidase, using o-dianisidine and
H2O2 as substrates.
Molecular Modeling.
Models of the seven TM helices were
taken from the PDB bovine rhodopsin file 1f88 (Palczewski et al.,
2000
). The starting structure of gpH2R TM domains
was constructed from a multiple sequence-alignment of bovine rhodopsin
with h
2AR (Palczewski et al., 2000
),
gpH1R, hH2R, and
gpH2R (Gantz et al., 1991
; Traiffort et al.,
1995
; Hill et al., 1997
). The resulting TM helices in hH2R and gpH2R are
highlighted in bold (Fig. 2). First, the model was roughly minimized by
the steepest descent method to remove bad contacts due to the mutated
residues. In the first 100 steps, the backbone was fixed. Energy
calculations were based on the Kollman all-atom force field (Kollman
charges, distant dependent dielectricity constant of 4). Then IMP
(5) and ARP (8) were manually docked into the
model in a conformation suggested to be active from 3D QSAR results
(Dove and Buschauer, 1998
, 1999
). The selection of amino acids
interacting with the imidazolylpropylguanidine moiety based on studies
with hH2R (Gantz et al., 1992
),
h
2AR (Wieland et al., 1996
; Isogaya et al.,
1999
), and hH1R (Wieland et al., 1999
) mutants.
The docking with respect to TM 6 and 7 was only roughly suggested by
seeking a pocket near the "hot" region around Asp-271 that may
accommodate the imidazole and the pyridine moiety of IMP and ARP,
respectively. Kollman all-atom types were assigned to IMP and ARP by
analogy, including definition of the new atom type F (fluorine).
Missing parameters (e.g., for bonds CA---NB, CC---CC, F---CA, and a
number of bond angles) were derived from similar types or from the
Tripos force field. As hydrogen bonding parameters for F-H3, the
respective values for O and N were assigned. Both ligands were provided
with Gasteiger-Hueckel charges. The complexes were fully minimized
(distant dependent dielectricity constant of 1) without constraints by
the Powell method down to an RMS gradient of less than 0.05. All
calculations were performed with SYBYL 6.7 (Tripos, St. Louis, MO) on
an SGI Octane workstation (SGI, Mountain View, CA)
Miscellaneous. Protein concentrations were determined using the DC protein assay kit (Bio-Rad, Hercules, CA). All analyses of experimental data were performed with the Prism III program (GraphPad Software, San Diego, CA).
| |
Results and Discussion |
|---|
|
|
|---|
Immunological Detection of hH2R-Gs
S and
gpH2R-Gs
S in Sf9 Cell Membranes.
Monomeric nonfused H2R expressed in Sf9 cells
migrates as ~33-kDa band in SDS-PAGE (Fukushima et al., 1997
), and
the apparent molecular mass of Gs
S is ~45
kDa. Thus, the molecular mass of
H2R-Gs
S fusion proteins
was expected to be ~78 kDa. In fact, the anti-FLAG Ig detected a
~78-kDa band in immunoblots (Fig. 3).
The intensities of immunologically detected bands in membranes
expressing hH2R-Gs
S and
gpH2R-Gs
S were similar to the band intensities in membranes expressing
2AR-Gs
L fusion
protein at 7.0 pmol/mg as determined by [3H]DHA
saturation binding. The ~44-kDa band in membranes expressing
2AR-Gs
L represents a
degradation product of the fusion protein that was generated as the
result of incidental freeze/thaw cycles. The membranes expressing
H2R-Gs
S did not undergo
such cycles, and accordingly, we did not observe degradation products.
In membranes expressing
hH2R-Gs
S and, to a much
lesser extent, in membranes expressing
gpH2R-Gs
S, we also
observed ~160-kDa bands. The H2R is known to
form homodimers (Fukushima et al., 1997
), and thus the ~160-kDa bands
most probably represent
H2R-Gs
S fusion protein
homodimers.
|
[3H]TIO- and [35S]GTP
S Saturation
Binding to hH2R-Gs
S and
gpH2R-Gs
S Expressed in Sf9 Cell
Membranes.
Native gpH2R binds
[3H]TIO with a Kd
value of ~17 nM (Gajtkowski et al., 1983
). However, the use of
[3H]TIO in native organs is severely limited by
the fact that nonspecific binding with saturating
[3H]TIO concentrations amounts to ~85 to 90%
of total [3H]TIO binding. In Sf9 membranes,
only ~55 to 65% nonspecific [3H]TIO binding
occurred with saturating radioligand concentrations. Therefore, a more
precise determination of the kinetics of specific [3H]TIO binding was possible (Fig.
4).
H2R-Gs
S fusion proteins expressed in Sf9 membranes bound [3H]TIO
according to monophasic saturation curves:
hH2R-Gs
S with a
Kd value of 32.0 ± 4.6 nM and a
Bmax value of 0.43 ± 0.02 pmol/mg
(SP166); gpH2R-Gs
S with
a Kd value of 34.4 ± 8.4 nM and a
Bmax value of 0.72 ± 0.02 pmol/mg
(SP391). Although the Kd values for
[3H]TIO fit well to the
KB values for TIO in the GTPase competition studies with HIS (Table 1), we would have
expected Bmax values of ~5 to 7 pmol/mg
for H2R-Gs
S fusion
proteins.
|
|
S fusion proteins.
[3H]TIO could either bind to only a fraction of
the functionally active fusion protein molecules or the majority of the
expressed molecules could be inactive. To discriminate between these
alternatives, we took advantage of the fact that in
GPCR-G
fusion proteins, 1 mol of protein binds
~1 mol of [35S]GTP
S when fully activated
(Wenzel-Seifert and Seifert, 2000
S binding was 5.2 ± 0.6 pmol/mg for hH2R-Gs
S
(SP166) and 8.7 ± 1.1 pmol/mg for
gpH2R-Gs
S (SP391). These
values fit well to the immunological data (Fig. 3) and suggest that
almost all of the expressed
H2R-Gs
molecules are
functionally active. Accordingly, the majority of ligand-free
H2R-Gs
molecules exist
in a conformation that does not bind [3H]TIO.
Future studies will have to determine whether
H2R-Gs
differentially
binds [3H]TIO and another
H2R radioligand,
[125I]iodoaminopotentidine (Hill et al., 1997Similar Antagonist Potencies at hH2R-Gs
S
and gpH2R-Gs
S Expressed in Sf9 Cell
Membranes and Evidence that RAN and APT Differentially Stabilize an
Inactive Conformation in H2R Species Isoforms.
In
GPCR-G
fusion proteins, the GTPase assay is a
highly sensitive method to determine ligand potencies and efficacies (Seifert et al., 1999
; Milligan, 2000
). GTP hydrolysis in Sf9 membranes
expressing H2R-Gs
S
fusion proteins was stimulated with HIS at a submaximally effective
concentration, and the HIS-stimulated GTP hydrolysis was inhibited by
H2R antagonists of various chemical classes. The
KB values for CIM (14), RAN
(15), ZOL (16), TIO (17), FAM
(18), and APT (19) did not vary by more than a
factor of 2 between
hH2R-Gs
S and
gpH2R-Gs
S (Table 1). We
correlated pKB values of antagonists at
hH2R-Gs
S versus
gpH2R-Gs
S. If the
antagonist-affinities of
hH2R-Gs
S and
gpH2R-Gs
S were
identical, we would expect a linear correlation with a slope of 1.00 that follows the dotted line in Fig. 5A.
Indeed, we obtained a highly significant correlation with a slope of
0.98 close to the theoretical curve (Fig. 5A), indicating that the
antagonist-binding properties of
hH2R-Gs
S and
gpH2R-Gs
S are very
similar. This is an important finding, because for other GPCR species
isoforms, including the H3R, differences in
antagonist-binding properties were observed (Kopin et al., 2000
;
Ligneau et al., 2000
; Lovenberg et al., 2000
).
|
S (Table 1). APT
(19), which had not been studied in this respect previously, was a much more efficient inverse agonist than RAN (15) at
hH2R-Gs
S. At
gpH2R-Gs
S, RAN showed
the greatest inverse agonist effect among the antagonists studied, and
the effect of RAN at
gpH2R-Gs
S was also
significantly greater than at
hH2R-Gs
S. Conversely,
APT was considerably more efficient as an inverse agonist at
hH2R-Gs
S than at
gpH2R-Gs
S. These data
show that RAN and APT differentially stabilize an inactive conformation in hH2R and gpH2R. In
support of the hypothesis that different H2R
antagonists stabilize unique conformations in
H2Rs from different species is the finding that
at the rat H2R, burimamide is a neutral antagonist, whereas at hH2R, it is a partial
agonist (Alewijnse et al., 1998
S and of RAN at
gpH2R-Gs
S, respectively,
were similar, indicating that both GPCRs exhibit a similar degree of
constitutive activity. In comparison, the rat H2R
is less constitutively active than hH2R
(Alewijnse et al., 1998
2AR (Chidiac et al., 1996
S and not Gs
L (see
Experimental Procedures). Specifically, it is known that
Gs
L confers the properties of constitutive
activity to the
2AR; i.e.,
Gs
L increases inverse agonists effects,
whereas Gs
S does not have these effects
(Seifert et al., 1998b
L, thereby increasing inverse agonist effects.
Agonist Efficacies, Potencies and Affinities at
hH2R-Gs
S and
gpH2R-Gs
S Expressed in Sf9 Cell Membranes:
Evidence that Guanidines Stabilize an Active Conformation in
gpH2R More Efficiently and Potently Than in
hH2R.
We determined the efficacies and potencies of
the small H2R agonists 1 to
4 and of the larger H2R agonists
5 to 13 in the GTPase assay (Table
2). The efficacies of HIS (1),
DIM (2), AMT (3), and BET (4) were
similar at hH2R-Gs
S and
gpH2R-Gs
S, respectively. In contrast, the efficacies of the guanidines 5 to
13 at
hH2R-Gs
S were all
significantly lower than at
gpH2R-Gs
S. The
differences in efficacy were most prominent for BU-E-43 (7), BU-E-48 (10), and D281 (13). Specifically,
elongation of the alkyl chain between the guanidino group and the
phenyl ring (6
7) and introduction of a bulky
Br atom (6
10) or of multiple Cl atoms into
the phenyl ring (12
13) had pronounced
negative effects on agonist efficacy at
hH2R-Gs
S but not at
gpH2R-Gs
S. Accordingly, the slope of the correlation of the efficacies of agonists at hH2R-Gs
S and
gpH2R-Gs
S was very
shallow, and the theoretical curve assuming pharmacological identity of
H2R species isoforms was not approached within
the data interval (Fig.
6A). Particularly informative is the comparison of the efficacies of BET (4) and guanidines 8 to 11. At
hH2R-Gs
S, these compounds possess efficacies of 0.73 to 0.87, but only guanidines have
increased efficacies at
gpH2R-Gs
S (Table 2).
Taken together, these results indicate that the
hH2R-Gs
S and
gpH2R-Gs
S conformations
stabilized by one of the small agonists 1 to 4 similarly promote GDP/GTP exchange. In contrast, the guanidines
5 to 13 stabilize a
hH2R-Gs
S conformation considerably less efficient for GDP/GTP exchange than the corresponding gpH2R-Gs
S conformation.
|
|
S and
gpH2R-Gs
S (Table 2). The
correlation of the pD2 values of compounds
1 to 4 at both
H2R-Gs
S was highly
significant with a slope close to the theoretical curve assuming
pharmacological identity of H2R species isoforms
(Fig. 5B). Except for BU-E-43 (7), the potencies of
guanidines were all significantly lower at
hH2R-Gs
S than at
gpH2R-Gs
S. Differences
in potency between
hH2R-Gs
S and
gpH2R-Gs
S were
particularly large for BU-E-75 (11) (6.6-fold), BU-E-42
(6) (6.0-fold), and IMP (5) (5.0-fold). The slope
of the correlation between the pD2 values
of guanidines at
hH2R-Gs
S and
gpH2R-Gs
S was 0.89, and
the curve nearly paralleled the theoretical curve assuming
pharmacological identity of H2R species isoforms
(Fig. 6B), indicating a constant contribution of the guanidinoalkylaryl moiety to the ligand/GPCR interaction difference between
hH2R and gpH2R. Notably,
agonist potency decreased almost 3-fold at gpH2R-Gs
S by elongation
of the alkyl chain between the guanidino group and the phenyl ring
(6
7) (Fig. 1), but slightly increased at
hH2R-Gs
S. These data
indicate that the guanidine binding pocket in
gpH2R is smaller or less flexible than in
hH2R. Taken together, guanidines stabilize an
active conformation in gpH2R not only more
efficiently but also more potently than in hH2R,
and the structure-activity relationships for guanidines at
hH2R and gpH2R are slightly different.
To further corroborate the concept of species-specific
H2R conformations stabilized by guanidines, we
competed [3H]TIO binding to
H2R-Gs
S fusion proteins
with unlabeled guanidines. In the absence of guanine nucleotides,
agonist, GPCR, and G-protein form a ternary complex that is
characterized by high agonist affinity (Seifert et al., 1998a
S reduces
agonist affinity, presumably reflecting ternary complex dissociation.
However, in some cases, high-affinity agonist binding is
GTP
S-insensitive, indicative of tight GPCR/G-protein coupling
(Seifert et al., 1998a
S and
gpH2R-Gs
S in the absence
and presence of GTP
S, and Table 3
provides a summary of the nonlinear regression analysis. The
Kl-values of guanidines 5,
8, and 10 at
hH2R-Gs
S were all higher
than at gpH2R-Gs
S. All
Kl values were much more similar to the
corresponding EC50 in the GTPase assay than the
Kh values (Tables 2 and 3). These data
suggest that H2Rs in a conformation with low
affinity for guanidines can efficiently mediate GDP/GTP exchange. An
explanation for the moderate divergence between
Kl and EC50 values
could be that individual guanidines may interact differently with
[3H]TIO-bound and ligand-free
H2R. Dissociations between agonist-affinities in
binding assays and agonist potencies in functional assays have been
observed for several GPCRs (Wenzel-Seifert et al., 1999
|
|
S and
gpH2R-Gs
S the
IMP-competition curves in the absence of GTP
S were monophasic (Fig.
7, A and B). GTP
S shifted the IMP-competition curves at both fusion
proteins to the right, indicating that despite our inability to resolve high- and low-affinity binding components, IMP still formed a ternary
complex with H2R-Gs
S.
Intriguingly, with
gpH2R-Gs
S, the
IMP-competition curve in the presence of GTP
S was biphasic, suggesting partial stability of the ternary complex of IMP-liganded gpH2R with GTP
S-liganded
Gs
S. The ternary complex in the hH2R-Gs
S system seems to
be less stable as indicated by the monophasic IMP-competition curve in
the presence of GTP
S. ARP was highly efficient at stabilizing the
ternary complex in both H2R-Gs
S fusion proteins
(Fig. 7, C and D). In
hH2R-Gs
S, GTP
S
abolished ternary complex formation with ARP, as reflected by the
monophasic and strongly rightward-shifted agonist competition curve
(Fig. 7C). In marked contrast, at
gpH2R-Gs
S, GTP
S had
only a small effect on the ARP-competition curve (Fig. 7D), indicating
high stability of the ternary complex in the presence of
GTP
S-liganded Gs
S. Similar to ARP, the
binding of BU-E-48 (10) at
hH2R-Gs
S was highly
GTP
S-sensitive, and at gpH2R-Gs
S it was largely
GTP
S-insensitive (Fig. 7, E and F). Collectively, these data
indicate that the conformations of gpH2R
stabilized by guanidines interact more tightly with
Gs
S than the corresponding conformations of
hH2R. Because of this different GPCR/G-protein
interaction, guanidines promote steady-state GDP/GTP exchange through
gpH2R more efficiently than through
hH2R (Fig. 6 and Table 2).
Molecular Analysis of Guanidine/H2R Interactions.
The crystal structure of bovine rhodopsin (Palczewski et al., 2000
) has
improved the reliability of GPCR models with bound ligands. To
elucidate the structural basis for the differences in interactions of
guanidines with H2R species isoforms, we built three-dimensional models of the seven TM helices of
gpH2R starting from the PDB rhodopsin file 1f88
and using the alignment with the
2AR
(Palczewski et al., 2000
). Additionally, our previous 3D QSAR data
obtained by comparative molecular field analysis, correlating
pD2 values of guanidines at
gpH2R-atrium with electrostatic and steric field
variables, were considered (Dove and Buschauer, 1998
, 1999
), in
particular for defining the conformation and
superposition of structures.
-helical TM5, the proposed two hydrogen bonds of the imidazole
ring with H2R are only possible with Tyr-182 and
Asp-186. This assumption is also in agreement with a pH-dependent model
of H2R activation that suggests tautomerization
of the imidazole into the N
-H form caused by
neutralization of HIS upon binding and accompanied by proton transfers
from Tyr-182 to N
and from
N
to Asp-186, respectively (Giraldo, 1999
2AR (Wieland et al., 1996
-OH group of epinephrine and with the
imidazolylethyl side chain of HIS, respectively. The corresponding
residue in TM6 of the H2R, Phe-254, is near imidazolylpropyl side chain only if agonists do not deeply penetrate into the GPCR core. The selected orientation of the guanidines in Figs.
8 and 9, therefore, is in agreement with our present knowledge on
biogenic amine/GPCR interactions.
|
|
Phe-269, Ala-271
Asp-271,
and Ile-272
Val-272) (Fig. 2). With our rhodopsin-based alignment
of TM7, only Asp-271 is capable of directly participating in ligand
binding. Intriguingly, the Ala-271
Asp-271 switch is the only
nonconserved amino acid exchange between hH2R and
gpH2R in TM7. The model in Fig. 8 suggests that
the preference of IMP for gpH2R relative to
hH2R is caused by an H-bond of the
N
H function to Asp-271. For the pyridyl moiety
of ARP, an ion-dipole interaction with Asp-271 is possible (Fig. 9) in
agreement with our 3D QSAR results (Dove and Buschauer, 1998
S in which
Ala-271 is exchanged against Asp-271 (Fig.
10A). Additionally, we took advantage
of a KpnI site present in the cDNA of both
hH2R and gpH2R (Fig. 2).
KpnI cleaves the cDNAs of hH2R and
gpH2R at the same position localized in the
middle of the second intracellular loop (Fig. 2). Thus, we could
readily construct chimeras in which the N- and C-terminal portions of
hH2R and gpH2R were
exchanged against each other (Fig. 10A).
NhCgpH2R-Gs
bears Cys-17
and Asp-271, and
NgpChH2R-Gs
bears Tyr-17
and Ala-271. The chimeras could be used 1) to study the role of
Asp-271/Ala-271 in the interaction with guanidines and 2) to study the
importance of the suggested H-bond between Tyr-17 and Asp-271 for the
effects of guanidines at gpH2R. In
hH2R-Gs
, both chimeras
and hH2R-A271D-Gs
this
interaction cannot take place anymore because either of the two amino
acids is replaced (Fig. 1).
|
S,
NgpChH2R-Gs
S, and
NhCgpH2R-Gs
S, like
hH2R-Gs
S and
gpH2R-Gs
S, had a
molecular mass of ~78 kDa (Fig. 10B). The expression levels of the
membrane preparations shown in Fig. 10 were quite different, but this
does not reflect intrinsic differences in the expression levels of
constructs. Specifically, Fig. 3 contains immunoblots in which
hH2R-Gs
S and
gpH2R-Gs
S were expressed at higher levels than in those displayed in Fig. 10, and similar data
were obtained for
NhCgpH2R-Gs
S (data not
shown). Membranes with different expression levels were intentionally
chosen for the immunoblot in Fig. 10 because certain features, namely
the double bands of
H2R-Gs
fusion proteins
corresponding to differently glycosylated species (Liu et al., 2001
S and hH2R-A271D-Gs
S migrating
at ~160 kDa. The immunoblot with anti-Gs
Ig
confirmed that H2R-Gs
fusion proteins migrate as a monomer of ~78 kDa and a dimer of ~160
kDa (Fig. 10C). Three additional bands at ~50 to 60 kDa not
identified with the anti-FLAG Ig are seen in the immunoblot with
anti-Gs
. They do not correspond to the
endogenous Gs
-like G-protein of insect cells
because the anti-Gs
Ig did not recognize an
antigen in membranes from uninfected Sf9 cells (Fig. 10C). The bands
also do not represent degradation products since the immunoblot with
the anti-FLAG Ig did not provide an indication (compare also with the
partial degradation of
2AR-Gs
L shown in Fig.
3). Rather, we assume that the ~50- to 60-kDa proteins are atypically
migrating H2R-Gs
fusion proteins that, because of specific N-terminal glycosylation patterns, are recognized only by the C-terminally reacting
anti-Gs
Ig but not with the N-terminally
reacting anti-FLAG Ig. Glycosylation-dependent reactions of fusion
proteins with anti-FLAG Ig and anti-Gs
Ig and
atypical migrations of GPCRs in SDS-PAGE have been observed earlier
(Grünewald et al., 1996
Ig show that
hH2R-A271D-Gs
S,
NgpChH2R-Gs
S, and
NhCgpH2R-Gs
S are
expressed in Sf9 cell membranes and that the electrophoretic mobility
of those fusion proteins is similar to the mobility of fusion proteins
containing wild-type H2Rs.
Table 4 summarizes the potencies and
efficacies of HIS (1) and guanidines 5 to
8, 10, 11, and 13 at the
GTPase of
hH2R-A271D-Gs
S,
NgpChH2R-Gs
S, and
NhCgpH2R-Gs
S. Figure 6,
C-H, shows correlations of the efficacies and potencies, respectively
of guanidines at
hH2R-A271D-Gs
S, NgpChH2R-Gs
S and
NhCgpH2R-Gs
S,
respectively, versus gpH2R-Gs
S and allow
direct comparison with the properties of
hH2R-Gs
S versus
gpH2R-Gs
S (Fig. 6, A and
B). Most strikingly, the correlation between the
pD2 values of guanidines at
hH2R-A271D-Gs
S and
gpH2R-Gs
S almost exactly
followed the theoretical curve assuming pharmacological identity of the two fusion proteins (Fig. 6D). Thus, the Ala-271
Asp-271 mutation increased the potency of hH2R for guanidines to
the level of gpH2R (compare Fig. 6, B and D, and
Tables 2 and 4). These findings confirm the results of the 3D QSAR
(Dove and Buschauer, 1998
|
S
contains Ala-271 (Figs. 1 and 10A). As expected, the potencies of
guanidines at
NgpChH2R-Gs
S did not
approach the theoretical curve assuming pharmacological identity of
NgpChH2R-Gs
S and
gpH2R-Gs
S (Fig. 6F).
Like hH2R-A271D-Gs
S,
NhCgpH2R-Gs
S contains
Asp-271. Thus, the potencies of guanidines at
NhCgpH2R-Gs
S were
expected to be higher than at
hH2R-Gs
S and similar to
the potencies at
hH2R-A271D-Gs
S and
gpH2R-Gs
S. Overall, the
data fulfilled the predictions (Tables 2 and 4). As a result of the
increase in guanidine potency at
NhCgpH2R-Gs
S the
correlation between the pD2 values at
NhCgpH2R-Gs
S versus
gpH2R-Gs
S approached the
theoretical function assuming pharmacological identity (compare Fig. 6,
B and H), but not as close as in the case of
hH2R-A271D-Gs
S versus
gpH2R-Gs
S (compare Figs.
6, D and H). Such slightly reduced potencies were not unexpected,
because in NhCgpH2R-Gs
S, there is not only the Ala-271
Asp-271 exchange, but also 32 additional amino acid exchanges in various regions of the C-terminal half of the GPCR (Fig. 2). These exchanges can have multiple effects on
the arrangements of TM domains and thereby partially annihilate the
effect of the Ala-271
Asp-271 exchange on guanidine potency.
Regarding the properties of some specific agonists, it becomes obvious
that elongation of the alkyl chain between the guanidino group and the
phenyl ring (6
7) (Fig. 1) decreased agonist
potency at
hH2R-A271D-Gs
S and
NhCgpH2R-Gs
S by ~4-fold (Table 4). This decrease in potency is similar to that observed for compounds 6
7 at
gpH2R-Gs
S (Table 2).
Conversely, at
NgpChH2R-Gs
S and
hH2R-Gs
S the longer alkyl chain slightly increased agonist potency (Tables 2 and 4). These
data indicate that the amino acid at position 271 of H2R affects the size and flexibility of the
guanidine binding pocket. With Ala-271, the binding pocket is wider and
more flexible and accommodates the longer (7) as well as the
shorter guanidine (6). In contrast, with Asp-271, the fit of
the longer guanidine (7) must be probably enforced by
conformational strain.
Among all guanidines studied, the amino acid substitution at
position 271 had the greatest and most consistent impact on the potency
of IMP (5). Specifically, with Asp-271 the potencies of IMP
were consistently ~5- to 7-fold higher than with Ala-271, regardless
of whether fusion proteins with wild-type H2Rs,
mutated H2R, or chimeric
H2Rs were considered (Tables 2 and 4). For other
guanidines, the impact of the amino acid substitution at position 271 was less consistent. These data indicate that the binding of IMP to
H2R is considerably more dependent on interaction with Asp-271 than the binding of other guanidines to
H2R. Major structural features of IMP
(5) compared with the other guanidines studied
(6-13) are the possibility of a H-bond to
Asp-271 (see Fig. 8) and the absence of a phenyl branch (Fig. 1). In
the case of the guanidines 6-13, the weaker
ion-dipole interaction with Asp-271 may be compensated by electrostatic
interactions of the substituted phenyl group with Arg-257 and Glu-270
and by better fit of the pyridyl moiety into a pocket of aromatic
residues (see Fig. 9).
Another striking result of the studies with
hH2R-A271-D-Gs
S,
NgpChH2R-Gs
S, and
NhCgpH2R-Gs
S was that
the correlations of the efficacies of guanidines at the aforementioned
constructs versus
gpH2R-Gs
S remained
almost unchanged (Fig. 6, A, C, E, and G), indicating that neither
Asp-271 nor all 33 amino acids specific for the C-terminal half of
gpH2R restored high efficacy of guanidines
observed for gpH2R-Gs
S.
These data demonstrate that guanidine potency and efficacy are
independent H2R properties. Intriguingly, the
models in Figs. 8 and 9 point to the existence of a H-bond between
Tyr-17 and Asp-271, a couple of residues present only in
gpH2R-Gs
S. Thus, our
modeling and experimental data suggest that the Tyr-Asp H-bond
stabilizes the agonistic conformation of the
gpH2R bound to guanidines.
It was also surprising that HIS is 2- to 3.5-fold more
potent at
hH2R-A271D-Gs
S and
NhCgpH2R-Gs
S (both with
Cys-17 and Asp-271) than at
gpH2R-Gs
S (Tables 2 and
4). TM1 and TM7 do not belong to the binding site of HIS, although it
cannot be ruled out that an unfixed Asp side chain in a more flexible TM7 can slightly improve the association kinetics of small amines by
"dynamic escorting".
| |
Conclusions |
|---|
|
|
|---|
In previous studies we observed that several guanidine-type
H2R agonists are less potent and/or less
efficient at the H2R of human neutrophils than at
the H2R of the guinea pig atrium (Burde et al.,
1989
, 1990
; Buschauer, 1989
). Taking advantage of the cloned
hH2R and gpH2R (Gantz et
al., 1991
; Traiffort et al., 1995
) and the
GPCR-G
fusion protein technique (Seifert et
al., 1999
; Milligan, 2000
) we were able to analyze the coupling of
hH2R and gpH2R to
Gs
S under identical experimental conditions. Using this approach, we have dissected pharmacological differences between hH2R and gpH2R with
respect to the inverse agonist efficacies of RAN (16) and
APT (19) and the agonist potencies and efficacies of
guanidines 5-13. Thus, our present data clearly
show that hH2R and gpH2R
possess, indeed, different pharmacological properties.
Guanidines stabilize an active conformation in
gpH2R more efficiently and potently than in
hH2R. Site-directed mutagenesis studies and
analysis of chimeric
hH2R/gpH2R receptors
confirmed computer modeling proposing that Asp-271 accounts for the
high potency of guanidines. The gpH2R model also
suggests that high guanidine efficacy depends on an H-bond between
Asp-271 and Tyr-17 that is not possible in any other
H2R-Gs
construct
studied. Thus, our data show that hH2R and
gpH2R selectively interact with a single class of
synthetic agonists, that high guanidine potency critically depends on
interaction with a single single amino acid, and that agonist potency
and efficacy are regulated independently of each other. The inverse
order of potency of compounds 6 and 7 at
hH2R and gpH2R,
respectively, indicates that it is possible to develop guanidines with
potency at hH2R. Such compounds may be useful for
treating cardiac failure, acute myelogenous leukemia, and inflammatory diseases.
Our present study adds the H2R to the
growing list of GPCR species isoforms that interact similarly with
their endogenous ligand, but quite differently with synthetic ligands
(Kopin et al., 2000
; Ligneau et al., 2000
; Lovenberg et al., 2000
).
Many GPCR species isoforms, including the H3R,
differ from each other primarily in antagonist pharmacology (Kopin et
al., 2000
; Ligneau et al., 2000
; Lovenberg et al., 2000
). From a
historical perspective, it is very fortunate that the pharmacological
differences between hH2R and
gpH2R mainly concern agonists and not antagonists
(Fig. 5). Otherwise, it would have been much more difficult if not
impossible to develop potent H2R antagonists for
treatment of gastroduodenal ulcer disease in man relying on animal
models at a time when recombinant hH2R had not
yet been available. However, for future development of potent and
selective H2R agonists it will be crucial to
analyze hH2R and not gpH2R.
| |
Acknowledgments |
|---|
We thank Dr. I. Gantz (Ann Arbor, MI) for providing the cDNA of hH2R, Drs. E. Traiffort and J.-C. Schwartz (Paris, France) for providing the cDNA of gpH2R and Dr. F. Schalkhausser (Department of Pharmacy, University of Regensburg, Germany) for the synthesis of guanidine 13. We also thank Dr. U. Gether (Department of Medical Physiology, The Panum Institute, Copenhagen, Denmark) for stimulating discussions. Finally, we thank the reviewers for their very helpful critique and suggestions.
| |
Footnotes |
|---|
Received March 16, 2001; Accepted July 3, 2001
1 Present address: Quintiles Inc., Kansas City, Missouri.
This work was supported by a New Faculty Award of The University of Kansas (R.S.), the National Institutes of Health COBRE award 1-P20-RR15563, matching support from the State of Kansas and the University of Kansas (R.S.), grants of the Fonds der Chemischen Industrie (A.B.), and the Deutscher Akademischer Austauschdienst within the international network "Medicinal Chemistry" (A.B.). M.T.K. and T.B. contributed equally to this work.
Dr. Roland Seifert, Department of Pharmacology and Toxicology, The University of Kansas, 5064 Malott Hall, Lawrence, KS 66045. E-mail: rseifert{at}ukans.edu
| |
Abbreviations |
|---|
HIS, histamine;
AMT, amthamine;
DIM, dimaprit;
BET, betahistine;
GPCR, G-protein-coupled receptor;
HxR, histamine
Hx-receptor, where x is 1, 2, 3, or 4;
IMP, impromidine;
ARP, arpromidine;
CIM, cimetidine;
RAN, ranitidine;
FAM, famotidine;
TIO, tiotidine;
ZOL, zolantidine;
APT, aminopotentidine;
h, human;
gp, guinea pig;
Gs-proteins, family of G-proteins that mediates adenylyl cyclase activation;
Gs
S, short splice variant of the Gs-protein
Gs
;
Gs
L, long splice variant of the
Gs-protein Gs
;
2AR,
2-adrenoceptor;
2AR-Gs
L, fusion protein containing the
2AR and the long splice
variant of Gs
;
DHA, dihydroalprenolol;
PCR, polymerase
chain reaction;
bp, base pair(s);
3D QSAR, three-dimensional
quantitative structure-activity relationship;
gpH2R-Gs
S, fusion protein of the guinea pig
histamine H2-receptor and the short splice variant of
Gs
;
hH2R-A271D-Gs
S, fusion
protein of the human histamine H2-receptor bearing an
Ala
Asp mutation at position 271 and the short splice variant of
Gs
;
hH2R-Gs
S, fusion protein
of the human histamine H2-receptor and the short splice
variant of Gs
;
NhCgpH2R-Gs
S, fusion protein consisting of the N-terminal half of the human histamine
H2-receptor, the C-terminal half of the guinea pig histamine H2-receptor, and the short splice variant of
Gs
;
NgpChH2R-Gs
S, fusion
protein consisting of the N-terminal half of the guinea pig histamine
H2-receptor, the C-terminal half of the human histamine
H2-receptor, and the short splice variant of
Gs
;
TM, transmembrane domain of a G-protein-coupled
receptor;
PAGE, polyacrylamide gel electrophoresis.
| |
References |
|---|
|
|
|---|
2-adrenergic receptor.
Mol Pharmacol
50:
662-669[Abstract].
1- and
2-adrenergic receptors for subtype-selective agonists.
Mol Pharmacol
56:
875-885
olf possesses a lower GDP-affinity and deactivates more rapidly than Gs
short: Consequences for receptor-coupling and adenylyl cyclase activation.
J Neurochem
78:
325-338[Medline].
2-adrenoceptor-GTP-binding-protein interaction in Sf9 cells: High coupling efficiency in a
2-adrenoceptor-Gs
fusion protein.
Eur J Biochem
255:
369-382[Medline].
fusion proteins: an approach for the molecular analysis of receptor/G-protein coupling.
Trends Pharmacol Sci
20:
383-389[Medline].
splice variants on
2-adrenoreceptor-mediated signaling. The
2-adrenoreceptor coupled to the long splice variant of Gs
has properties of a constitutively active receptor.
J Biol Chem
273:
5109-5116
2-adrenoceptor coupling to Gs-, Gi-, and Gq-proteins.
Mol Pharmacol
58:
954-966
1, Gi
2, and Gi
3.
J Biol Chem
274:
33259-33266
2-adrenergic receptor.
Proc Natl Acad Sci USA
93:
9276-9281This article has been cited by other articles:
![]() |
H.-J. Wittmann, R. Seifert, and A. Strasser Contribution of Binding Enthalpy and Entropy to Affinity of Antagonist and Agonist Binding at Human and Guinea Pig Histamine H1-Receptor Mol. Pharmacol., July 1, 2009; 76(1): 25 - 37. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Strasser, H.-J. Wittmann, M. Kunze, S. Elz, and R. Seifert Molecular Basis for the Selective Interaction of Synthetic Agonists with the Human Histamine H1-Receptor Compared with the Guinea Pig H1-Receptor Mol. Pharmacol., March 1, 2009; 75(3): 454 - 465. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Strasser, B. Striegl, H.-J. Wittmann, and R. Seifert Pharmacological Profile of Histaprodifens at Four Recombinant Histamine H1 Receptor Species Isoforms J. Pharmacol. Exp. Ther., January 1, 2008; 324(1): 60 - 71. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. B. Damaj, C. B. Becerra, H. J. Esber, Y. Wen, and A. A. Maghazachi Functional Expression of H4 Histamine Receptor in Human Natural Killer Cells, Monocytes, and Dendritic Cells J. Immunol., December 1, 2007; 179(11): 7907 - 7915. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Preuss, P. Ghorai, A. Kraus, S. Dove, A. Buschauer, and R. Seifert Constitutive Activity and Ligand Selectivity of Human, Guinea Pig, Rat, and Canine Histamine H2 Receptors J. Pharmacol. Exp. Ther., June 1, 2007; 321(3): 983 - 995. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Preuss, P. Ghorai, A. Kraus, S. Dove, A. Buschauer, and R. Seifert Mutations of Cys-17 and Ala-271 in the Human Histamine H2 Receptor Determine the Species Selectivity of Guanidine-Type Agonists and Increase Constitutive Activity J. Pharmacol. Exp. Ther., June 1, 2007; 321(3): 975 - 982. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-X. Xie, A. Kraus, P. Ghorai, Q.-Z. Ye, S. Elz, A. Buschauer, and R. Seifert N1-(3-Cyclohexylbutanoyl)-N2-[3-(1H-imidazol-4-yl)propyl]guanidine (UR-AK57), a Potent Partial Agonist for the Human Histamine H1- and H2-Receptors J. Pharmacol. Exp. Ther., June 1, 2006; 317(3): 1262 - 1268. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-X. Xie, P. Ghorai, Q.-Z. Ye, A. Buschauer, and R. Seifert Probing Ligand-Specific Histamine H1- and H2-Receptor Conformations with NG-Acylated Imidazolylpropylguanidines J. Pharmacol. Exp. Ther., April 1, 2006; 317(1): 139 - 146. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bruysters, A. Jongejan, M. Gillard, F. van de Manakker, R. A. Bakker, P. Chatelain, and R. Leurs Pharmacological Differences between Human and Guinea Pig Histamine H1 Receptors: Asn84 (2.61) as Key Residue within an Additional Binding Pocket in the H1 Receptor Mol. Pharmacol., April 1, 2005; 67(4): 1045 - 1052. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Seifert, K. Wenzel-Seifert, T. Burckstummer, H. H. Pertz, W. Schunack, S. Dove, A. Buschauer, and S. Elz Multiple Differences in Agonist and Antagonist Pharmacology between Human and Guinea Pig Histamine H1-Receptor J. Pharmacol. Exp. Ther., June 1, 2003; 305(3): 1104 - 1115. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||