Introduction

Top Abstract Introduction Experimental Procedures Results and Discussion Conclusions References

HIS (1) is a biogenic amine (Fig. 1) that functions as a neurotransmitter and autacoid (Hill et al., 1997). HIS exerts its effects through at least four receptor subtypes, designated H₁, H₂, H₃, and H₄, respectively (Hill et al., 1997; Hough, 2001). HIS receptors belong to the superfamily of GPCRs that possess seven transmembrane domains, three extracellular and three intracellular loops. The H₂R couples to G_s-proteins to activate adenylyl cyclase. Numerous H₂R agonists and antagonists have been developed; the guinea pig atrium has been the standard model for ligand design for decades (Ganellin, 1982; Hill et al., 1997). Figure 1 shows the structures of prototypical H₂R agonists and antagonists. Among agonists, DIM (2), AMT (3), and BET (4) are similar to HIS (1). BET is a nonselective H₂R partial agonist (Ganellin, 1982; Burde et al., 1989) and is therefore an interesting experimental tool. Compared with compounds 1 to 4, the guanidines 5 to 13 are long-chained and more bulky. IMP (5), ARP (8), and several ARP analogs are much more potent in the guinea pig atrium than HIS (Durant et al., 1978; Buschauer, 1989). H₂R antagonists are divided into five chemical classes: imidazoles such as CIM (14), furans such as RAN (15), thiazoles such as FAM (16), and TIO (17), piperidinomethylphenoxy derivatives such as ZOL (18), and (benzamidoalkyl)cyanoguanidines such as APT (19) (Hill et al., 1997). H₂R antagonists are of great importance for the treatment of gastroduodenal ulcer disease (Hill et al., 1997). H₂R agonists may be useful as positive inotropic drugs for the treatment of heart failure (Felix et al., 1995), as differentiation-inducing agents in acute myelogenous leukemia (Seifert et al., 1992), and as anti-inflammatory drugs (Burde et al., 1990).

View larger version (23K): [in this window] [in a new window]   Fig. 1.   Structures of H2R agonists and antagonists. 1 to 13, agonists; 14 to 19, antagonists. 6 to 13 represent arpromidine-derived guanidines.

Guanidine-type compounds are less potent and/or efficient agonists at the H₂R of human neutrophils than at the H₂R of the guinea pig atrium (Burde et al., 1989, 1990; Buschauer, 1989). Additionally, several GPCR species isoforms, including the H₃R, differ from each other in their pharmacological properties as assessed by the analysis of recombinant GPCRs (Kopin et al., 2000; Ligneau et al., 2000; Lovenberg et al., 2000). There are relatively few amino acid differences between hH₂R and gpH₂R (Gantz et al., 1991; Traiffort et al., 1995) (Fig. 2), particularly in the established ligand-binding domains TM3 and TM5, but even a single amino acid exchange between GPCR species isoforms can strongly affect their pharmacological properties (Kopin et al., 2000; Ligneau et al., 2000). Based on these findings, the hypothesis arose that the H₂R exhibits species-specific pharmacological properties as well.

View larger version (19K): [in this window] [in a new window]   Fig. 2.   Comparison of the amino acid sequences of hH2R and gpH2R. The amino acid sequences of the cloned hH2R (Gantz et al., 1991) and gpH2R (Traiffort et al., 1995) are given in the one-letter code. Dots in the gpH2R sequence indicate identity with hH2R. TM domains are shown in bold. Amino acids shown in green in TM3 and TM5 represent the interaction sites of HIS with the H2R (Gantz et al., 1992; Nederkoorn et al., 1996). Amino acids shown in black in the gpH2R sequence represent conservative exchanges. Amino acids shown in red in the gpH2R sequence represent nonconservative exchanges. The arrow indicates the cleavage site of KpnI, present in the cDNA of both gpH2R and hH2R. The KpnI site allowed us to construct reciprocal hH2R/gpH2R chimeras (see Fig. 10). N-term, extracellular N-terminal domain of H2Rs; C-term, intracellular C-terminal domain of H2Rs.; i1, i2, and i3; 1st, 2nd, and 3rd intracellular loop, respectively; e1, e2, and e3, 1st, 2nd, and 3rd extracellular loop, respectively; TM1-7, transmembrane domains 1-7.

To test our hypothesis, we constructed fusion proteins of the hH₂R and gpH₂R, respectively, and G_sS and expressed the fusion proteins in Sf9 cell membranes. GPCR-G fusion proteins ensure a defined 1:1 stoichiometry of the signaling partners and efficient coupling (Seifert et al., 1999; Milligan, 2000). The measurement of GTP hydrolysis in GPCR-G fusion proteins is presumably the most precise method currently available for the analysis of ligand potencies and efficacies, because the GTPase assay is a steady-state method, is extremely sensitive in GPCR-G_s fusion proteins, assesses GPCR/G-protein coupling directly at the G-protein level, and is independent of the expression level of the components (Seifert et al., 1999; Milligan, 2000). Finally, the analysis of H₂R species isoforms in the same host cell membrane annihilates the impact of pharmacokinetic differences between different test systems. Here, we report that hH₂R and gpH₂R exhibit distinct pharmacological properties, particularly with respect to interaction with guanidines.

	Experimental Procedures

Top Abstract Introduction Experimental Procedures Results and Discussion Conclusions References

Materials. The cDNA for the hH₂R was kindly provided by Dr. I. Gantz (University of Michigan Medical School and Ann Arbor VA Medical Center, Ann Arbor, MI) (Gantz et al., 1991). The cDNA for the gpH₂R was kindly provided by Drs. E. Traiffort and J.-C. Schwartz (Department of Neurobiology and Pharmacology, Center Paul Broca, Institut National de la Santé et de la Recherche Médicale, Paris, France) (Traiffort et al., 1995). The generation of the baculovirus encoding ₂AR-G_sL had been described previously (Seifert et al., 1998a). APT was synthesized as described previously (Hirschfeld et al., 1992). IMP was prepared as described previously (Durant et al., 1978). Guanidines 6 to 11 were synthesized as described previously (Buschauer, 1989). Guanidines 12 and 13 (Schalkhausser, 1998) were prepared by analogy to the procedures described for guanidines 6 to 11 (Buschauer, 1989). The structures of the synthesized compounds were confirmed by analysis (C, H, N), ¹H NMR, and mass spectroscopy spectra. Purity of compounds was >98% as determined by high-performance liquid chromatography or capillary electrophoresis (Schuster et al., 1997). The anti-FLAG Ig (M1 monoclonal antibody) was from Sigma (St. Louis, MO). The anti-G_s Ig (C-terminal) was from Calbiochem (La Jolla, CA). [-³²P]GTP (6000 Ci/mmol), [³⁵S]GTPS (1100 Ci/mmol), [³H]DHA (85-90 Ci/mmol), and [³H]TIO (90 Ci/mmol) were from PerkinElmer Life Sciences (Boston, MA). All unlabeled nucleotides were from Roche (Indianapolis, IN). HIS, BET, CIM, RAN, and FAM were from Sigma. AMT, TIO, and ZOL were from Tocris Cookson (Ballwin, MO). DIM was from RBI (Natick, MA). All restriction enzymes and T4 DNA ligase were from New England Biolabs (Beverly, MA). Cloned Pfu DNA polymerase was from Stratagene (La Jolla, CA).

Construction of FLAG Epitope- and Hexahistidine-Tagged cDNA for hH₂R-G_sS. A DNA sequence encoding the cleavable signal peptide from influenza hemagglutinin (S) followed by the FLAG epitope (F), which is recognized by the M1 antibody, was placed 5' of the start codon of the hH₂R to enhance GPCR expression and allow immunological detection. We also added a hexahistidine tag to the C terminus of hH₂R to allow future purification and to provide additional protection against proteolysis (Seifert et al., 1998a). The GPCR modifications were generated by sequential overlap-extension PCRs. In PCR 1A, the DNA sequence of the N-terminal portion of the hH₂R was amplified using CMVneo-hH₂R as template. The sense primer annealed with the first 18 bp of the 5'-end of the hH₂R and included the last 18 bp of the SF in its 5'-extension. The antisense primer encoded the sequence GAGCTGTTGATATCCGGTGCGGAAGTCTCTG to generate a silent mutation yielding a new EcoRV site. In PCR 1B, the DNA sequence of the C-terminal portion of the hH₂R was amplified using CMVneo-hH₂R as template. The sense primer encoded the sequence TTCCGCACCGGATATCAACAGCTCTTCTGCTGC to generate the new EcoRV site. The antisense primer encoded the five C-terminal amino acids of the hH₂R, a hexahistidine tag, the stop codon and an XbaI site. In PCR 2, the products of PCRs 1A and 1B annealed in the region encoding the newly created EcoRV site. In PCR 2, the sense primer of PCR 1A and the antisense primer of PCR 1B were used. In this way, a fragment encoding the signal sequence, the FLAG epitope, hH₂R cDNA with a new EcoRV site and a hexahistidine tag followed by an XbaI site was obtained. This fragment was digested with NcoI and XbaI and cloned into pGEM-3Z-SF-human formyl peptide receptor-6His digested with NcoI and XbaI. In PCR 3A, the C-terminal portion of the H₂R was amplified using pGEM-3Z-SF-hH₂R as template, a sense primer annealing 5' of the newly created EcoRV site and an antisense primer annealing with the hexahistidine tag. In PCR 3B, the sequence of G_sS was amplified, using pGEM-3Z-SF-₂AR-G_sS as template, a sense primer annealing with the hexahistidine tag and an antisense primer annealing with the 5 C-terminal amino acids of G_s, the stop codon, and an XbaI site. In PCR 4, the products of PCRs 3A and 3B annealed in the hexahistidine region, and the sense primer of PCR 3A and the antisense primer of PCR 3B were used. In this way, a fragment encoding the C-terminal portion of the hH₂R, a hexahistidine tag, G_sS, a stop codon and an XbaI site was created. This fragment was digested with EcoRV and XbaI and cloned into pGEM-3Z-SFhH₂R digested with EcoRV and XbaI. In this way, the full-length cDNA for hH₂R-G_sS was created. pGEM-3Z-SF-hH₂R-G_sS was digested with NcoI and XbaI to recover the fusion protein cDNA and cloned into the baculovirus transfer vector pVL 1392-SF-₂AR-G_i2 digested with NcoI and XbaI. PCR-generated DNA sequences were confirmed by extensive restriction enzyme analysis and enzymatic sequencing.

Construction of FLAG Epitope- and Hexahistidine-Tagged cDNA for gpH₂R-G_sS. The strategy for creation of gpH₂R-G_sS cDNA was analogous to the strategy for creation of hH₂R-G_sS cDNA. In PCR 1A, the DNA sequence of the N-terminal portion of gpH₂R was amplified using pGEM4Z-gpH₂R as template. The sense primer annealed with the first 20 bp of the 5'-end of the gpH₂R and included the last 8 bp of the SF in its 5'-extension. The antisense primer encoded the sequence CTCATGGGAGTTGTGGCTAGCGAGCCTGCAGCAGAAGAGC to create a silent mutation yielding a new NheI site. In PCR 1B, the sequence of the C-terminal portion of gpH₂R was amplified using pGEM4Z-gpH₂R as template. The sense primer encoded the sequence GCTCTTCTGCTGCAGGCTCGCTAGCCACAACTCCCATGAG to create the new NheI site. The antisense primer encoded the five C-terminal amino acids of the gpH₂R, a hexahistidine tag, the stop codon, and an XbaI site. In PCR 2, the products of PCRs 1A and 1B annealed in the region encoding the newly created NheI site. In PCR 2, the sense primer of PCR 1A and the antisense primer of PCR 1B were used. In this way, a fragment encoding the signal sequence, the FLAG epitope, gpH₂R cDNA with a new NheI site, and a hexahistidine tag followed by an XbaI site was obtained. This fragment was digested with NcoI and XbaI and cloned into pGEM-3Z-SF-human formyl peptide receptor-6His digested with NcoI and XbaI. In PCR 3A, the C-terminal portion of the gpH₂R was amplified using pGEM-3Z-SF-gpH₂R as template, a sense primer annealing 5' of the newly created NheI site, and an antisense primer annealing with the hexahistidine tag. In PCR 3B, the sequence of G_sS was amplified, using pGEM-3Z-SF-₂AR-G_sS as template, a sense primer annealing with the hexahistidine tag, and an antisense primer annealing with the 5 C-terminal amino acids of G_s, the stop codon, and an XbaI site. In PCR 4, the products of PCRs 3A and 3B annealed in the hexahistidine region, and the sense primer of PCR 3A and the antisense primer of PCR 3B were used. In this way, a fragment encoding the C-terminal portion of the gpH₂R, a hexahistidine tag, G_sS, a stop codon, and an XbaI site was created. This fragment was digested with NheI and XbaI and cloned into pGEM-3Z-SFgpH₂R digested with NheI and XbaI. In this way, the full-length cDNA for gpH₂R-G_sS was created. pGEM-3Z-SF-hH₂R-G_sS was digested with NcoI and XbaI to recover the fusion protein cDNA and cloned into the baculovirus transfer vector pVL 1392-SF-₂AR-G_i2 digested with NcoI and XbaI. PCR-generated DNA sequences were confirmed by extensive restriction enzyme analysis and enzymatic sequencing.

Construction of the cDNA for hH₂R-A271D-G_sS. The Ala-271  Asp-271 exchange in hH₂R was generated by sequential overlap-extension PCRs. In PCR 1A, the DNA sequence of the N-terminal portion of hH₂R was amplified using pGEM-3Z-SF-hH₂R-G_sS as a template. The sense primer annealed with the first 18 bp of the 5' end of hH₂R and included the last 18 bp of the SF in its 5' extension. The antisense primer encoded the sequence CAGAACGATATCTTCTAACACCTCATTGATGGCATC to generate the Ala-271  Asp-271 exchange and a new EcoRV site at the position of the mutated amino acid. In PCR 1B, the DNA sequence of the C-terminal portion of the hH₂R and the entire sequence of G_ss was amplified using pGEM-3Z-SF-hH₂R-G_sS as a template. The sense primer encoded the sequence GTTAGAAGATATCGTTCTGTGGCTGGGCTATGCCAAC to generate the Ala-271  Asp-271 exchange and a new EcoRV site at the position of the mutated amino acid. The antisense primer encoded the five C-terminal amino acids of G_s, the stop codon and an XbaI site. In PCR 2, the products of PCR 1A and 1B annealed in the region encoding the newly created Ala-271  Asp-271 exchange and the EcoRV site. In the PCR 2, the sense primer of PCR 1A and the antisense primer of PCR 1B were used. In this way, a fragment encoding the entire hH₂R-A271D-G_sS fusion protein was created. This fragment was digested with EcoRI and NcoI and cloned into pGEM-3Z-SF-hH₂R-G_sS digested with EcoRI and NcoI. pGEM-3Z-SF-hH₂R-A271D-G_sS was digested with SacI and EcoN I and cloned into the baculovirus transfer vector pVL 1392-SF-hH₂R-G_sS digested with SacI and EcoN I. PCR-generated DNA sequences were confirmed by extensive restriction enzyme analysis and enzymatic sequencing.

Construction of the cDNAs for NgpChH₂R-G_sS and NhCgpH₂R-G_sS. For construction of hH₂R/gpH₂R chimeras, we took advantage of the KpnI site present at the same position of the cDNAs of both receptors. KpnI cleaves hH₂R- and gpH₂R cDNA in the center of the second intracellular loop (Fig. 2). pGEM-3Z-SF-hH₂R-G_sS and pGEM-3Z-SF-gpH₂R-G_sS were digested with KpnI and XbaI so that the C-terminal halves of H₂Rs and the fused G_sS were cut out. The fragments obtained were reciprocally cloned back into pGEM-3Z-SF-hH₂R-G_sS and pGEM-3Z-SF-gpH₂R-G_sS. As a result of this exchange, we created pGEM-3Z-SF-NgpChH₂R-G_sS and pGEM-3Z-SF-NhCgpH₂R-G_sS. These plasmids were digested with NcoI and XbaI and cloned into the baculovirus transfer vector pVL 1392-SF-gpH₂R-G_sS digested with NcoI and XbaI. The chimeric H₂R-G_sS DNA sequences were confirmed by extensive restriction enzyme analysis.

Generation of Recombinant Baculoviruses, Cell Culture and Membrane Preparation. Recombinant baculoviruses encoding the H₂R-G_s fusion proteins were generated in Sf9 cells using the BaculoGOLD transfection kit (BD PharMingen, San Diego, CA) according to the manufacturer's instructions. After initial transfection, high-titer virus stocks were generated by two sequential virus amplifications. Sf9 cells were cultured in 250-ml disposable Erlenmeyer flasks at 28°C under rotation at 125 rpm in SF 900 II medium (Invitrogen, Carlsbad, CA) supplemented with 5% (v/v) fetal calf serum (BioWhittaker, Walkersville, MD) and 0.1 mg/ml gentamicin (BioWhittaker). Cells were maintained at a density of 0.5 to 6.0 × 10⁶ cells/ml. For infection, cells were sedimented by centrifugation and suspended in fresh medium. Cells were seeded at 3.0 × 10⁶ cells/ml and infected with a 1:100 dilution of high-titer baculovirus stocks encoding H₂R-G_sS fusion proteins. Cells were cultured for 48 h before membrane preparation. Sf9 membranes were prepared as described previously (Seifert et al., 1998a), using 1 mM EDTA, 0.2 mM phenylmethylsulfonyl fluoride, 10 µg/ml benzamidine, and 10 µg/ml leupeptin as protease inhibitors. Membranes were suspended in binding buffer (12.5 mM MgCl₂, 1 mM EDTA and 75 mM Tris/HCl, pH 7.4) and stored at 80°C until use.

Receptor Ligand Binding Assays. Membranes were thawed and sedimented by a 15-min centrifugation at 4°C and 15,000g to remove residual endogenous guanine nucleotides as much as possible. Membranes were resuspended in binding buffer (12.5 mM MgCl₂, 1 mM EDTA and 75 mM Tris/HCl, pH 7.4). In [³H]TIO binding assays, each tube (total volume, 250 µl) contained 200 to 250 µg of protein. Nonspecific binding was determined in the presence of [³H]TIO at various concentrations plus 100 µM unlabeled TIO. Incubations were conducted for 90 min at 25°C and shaking at 250 rpm. In saturation binding experiments, tubes contained 1 to 20 nM [³H]TIO plus unlabeled TIO to obtain final ligand concentrations of up to 300 nM. Competition binding experiments were carried out in the presence of 10 nM [³H]TIO and unlabeled ligands at various concentrations without or with GTPS (10 µM). Bound [³H]TIO was separated from free [³H]TIO by filtration through GF/C filters, followed by three washes with 2 ml of binding buffer (4°C). Filter-bound radioactivity was determined by liquid scintillation counting. The experimental conditions chosen ensured that not more than 5% of the total amount of [³H]TIO added to binding tubes was bound to filters. The expression level of ₂AR-G_sL was determined with 10 nM [³H]DHA as radioligand as described previously (Seifert et al., 1998a).

[³⁵S]GTPS Binding Assay. Membranes were thawed, sedimented, and suspended as for receptor ligand binding assays. Reaction mixtures (total volume, 500 µl) contained Sf9 membranes expressing H₂R-G_s fusion proteins (15 µg of protein/tube) in binding buffer supplemented with 0.05% (w/v) bovine serum albumin, 1 µM GDP, and 1 nM [³⁵S]GTPS plus 9 nM unlabeled GTPS. Reaction mixtures additionally contained distilled water (basal) and HIS at a saturating concentration (100 µM). Incubations were conducted for 90 min at 25°C and shaking at 250 rpm. Bound [³⁵S]GTPS was separated from free [³⁵S]GTPS by filtration through GF/C filters, followed by three washes with 2 ml of binding buffer (4°C). Filter-bound radioactivity was determined by liquid scintillation counting. The experimental conditions chosen ensured that no more than 10% of the total amount of [³⁵S]GTPS added was bound to filters.

Steady-State GTPase Activity Assay. Membranes were thawed, sedimented, and resuspended in 10 mM Tris/HCl, pH 7.4. Assay tubes contained Sf9 membranes expressing H₂R-G_s fusion proteins (10 µg of protein/tube), 1.0 mM MgCl₂, 0.1 mM EDTA, 0.1 mM ATP, 100 nM GTP, 1 mM adenylyl imidodiphosphate, 5 mM creatine phosphate, 40 µg of creatine kinase, and 0.2% (w/v) bovine serum albumin in 50 mM Tris/HCl, pH 7.4, and H₂R ligands at various concentrations. Reaction mixtures (80 µl) were incubated for 3 min at 25°C before the addition of 20 µl of [-³²P]GTP (0.2-0.5 µCi/tube). All stock and work dilutions of [-³²P]GTP were prepared in 20 mM Tris/HCl, pH 7.4. Reactions were conducted for 20 min at 25°C. Preliminary studies under basal conditions and with HIS, IMP, and ARP showed that under these conditions, GTP hydrolysis was linear. Reactions were terminated by the addition of 900 µl of slurry consisting of 5% (w/v) activated charcoal and 50 mM NaH₂PO₄, pH 2.0. Charcoal absorbs nucleotides but not P_i. Charcoal-quenched reaction mixtures were centrifuged for 15 min at room temperature at 15,000g. Seven hundred microliters of the supernatant fluid of reaction mixtures were removed, and ³²P_i was determined by liquid scintillation counting. Enzyme activities were corrected for spontaneous degradation of [-³²P]GTP. Spontaneous [-³²P]GTP degradation was determined in tubes containing all of the above described components plus a very high concentration of unlabeled GTP (1 mM) that, by competition with [-³²P]GTP, prevents [-³²P]GTP hydrolysis by enzymatic activities present in Sf9 membranes. Spontaneous [-³²P]GTP degradation was <1% of the total amount of radioactivity added using 20 mM Tris/HCl, pH 7.4, as solvent for [-³²P]GTP. The experimental conditions chosen ensured that not more than 10% of the total amount of [-³²P]GTP added was converted to ³²P_i.

SDS-PAGE and Immunoblot Analysis. Membrane proteins were separated on SDS polyacrylamide gels containing 8% (w/v) acrylamide. Proteins were then transferred onto Immobilon-P transfer membranes (Millipore, Bedford, MA). Membranes were reacted with M1 antibody or anti-G_s Ig (1:1000 each). Immunoreactive bands were visualized by sheep anti-mouse IgG (M1 antibody) and donkey anti-rabbit IgG (anti-G_s Ig), respectively, coupled to peroxidase, using o-dianisidine and H₂O₂ as substrates.

Molecular Modeling. Models of the seven TM helices were taken from the PDB bovine rhodopsin file 1f88 (Palczewski et al., 2000). The starting structure of gpH₂R TM domains was constructed from a multiple sequence-alignment of bovine rhodopsin with h₂AR (Palczewski et al., 2000), gpH₁R, hH₂R, and gpH₂R (Gantz et al., 1991; Traiffort et al., 1995; Hill et al., 1997). The resulting TM helices in hH₂R and gpH₂R are highlighted in bold (Fig. 2). First, the model was roughly minimized by the steepest descent method to remove bad contacts due to the mutated residues. In the first 100 steps, the backbone was fixed. Energy calculations were based on the Kollman all-atom force field (Kollman charges, distant dependent dielectricity constant of 4). Then IMP (5) and ARP (8) were manually docked into the model in a conformation suggested to be active from 3D QSAR results (Dove and Buschauer, 1998, 1999). The selection of amino acids interacting with the imidazolylpropylguanidine moiety based on studies with hH₂R (Gantz et al., 1992), h₂AR (Wieland et al., 1996; Isogaya et al., 1999), and hH₁R (Wieland et al., 1999) mutants. The docking with respect to TM 6 and 7 was only roughly suggested by seeking a pocket near the "hot" region around Asp-271 that may accommodate the imidazole and the pyridine moiety of IMP and ARP, respectively. Kollman all-atom types were assigned to IMP and ARP by analogy, including definition of the new atom type F (fluorine). Missing parameters (e.g., for bonds CA---NB, CC---CC, F---CA, and a number of bond angles) were derived from similar types or from the Tripos force field. As hydrogen bonding parameters for F-H3, the respective values for O and N were assigned. Both ligands were provided with Gasteiger-Hueckel charges. The complexes were fully minimized (distant dependent dielectricity constant of 1) without constraints by the Powell method down to an RMS gradient of less than 0.05. All calculations were performed with SYBYL 6.7 (Tripos, St. Louis, MO) on an SGI Octane workstation (SGI, Mountain View, CA)

Miscellaneous. Protein concentrations were determined using the DC protein assay kit (Bio-Rad, Hercules, CA). All analyses of experimental data were performed with the Prism III program (GraphPad Software, San Diego, CA).

	Results and Discussion

Top Abstract Introduction Experimental Procedures Results and Discussion Conclusions References

Immunological Detection of hH₂R-G_sS and gpH₂R-G_sS in Sf9 Cell Membranes. Monomeric nonfused H₂R expressed in Sf9 cells migrates as ~33-kDa band in SDS-PAGE (Fukushima et al., 1997), and the apparent molecular mass of G_sS is ~45 kDa. Thus, the molecular mass of H₂R-G_sS fusion proteins was expected to be ~78 kDa. In fact, the anti-FLAG Ig detected a ~78-kDa band in immunoblots (Fig. 3). The intensities of immunologically detected bands in membranes expressing hH₂R-G_sS and gpH₂R-G_sS were similar to the band intensities in membranes expressing ₂AR-G_sL fusion protein at 7.0 pmol/mg as determined by [³H]DHA saturation binding. The ~44-kDa band in membranes expressing ₂AR-G_sL represents a degradation product of the fusion protein that was generated as the result of incidental freeze/thaw cycles. The membranes expressing H₂R-G_sS did not undergo such cycles, and accordingly, we did not observe degradation products. In membranes expressing hH₂R-G_sS and, to a much lesser extent, in membranes expressing gpH₂R-G_sS, we also observed ~160-kDa bands. The H₂R is known to form homodimers (Fukushima et al., 1997), and thus the ~160-kDa bands most probably represent H₂R-G_sS fusion protein homodimers.

View larger version (23K): [in this window] [in a new window]   Fig. 3.   Analysis of the expression of H2R-GsS fusion proteins in Sf9 cell membranes. Various Sf9 cell membrane preparations (SP followed by number) expressing 2AR-GsL (7.0 pmol/mg as assessed by [3H]DHA saturation binding) and H2R-Gs fusion proteins were separated by SDS-PAGE using a gel that contained 8% (w/v) acrylamide. Fusion proteins were probed with the anti-FLAG Ig (M1 antibody). Each membrane preparation was analyzed in three different amounts (25, 50, and 100 µg of protein, respectively, from left to right). Numbers on the left of the immunoblot indicate molecular masses of marker proteins. Shown is the horseradish peroxidase-reacted Immobilon P membrane of a representative gel. Similar results were obtained with four other membrane preparations of hH2R-GsS and gpH2R-GsS each.

[³H]TIO- and [³⁵S]GTPS Saturation Binding to hH₂R-G_sS and gpH₂R-G_sS Expressed in Sf9 Cell Membranes. Native gpH₂R binds [³H]TIO with a K_d value of ~17 nM (Gajtkowski et al., 1983). However, the use of [³H]TIO in native organs is severely limited by the fact that nonspecific binding with saturating [³H]TIO concentrations amounts to ~85 to 90% of total [³H]TIO binding. In Sf9 membranes, only ~55 to 65% nonspecific [³H]TIO binding occurred with saturating radioligand concentrations. Therefore, a more precise determination of the kinetics of specific [³H]TIO binding was possible (Fig. 4). H₂R-G_sS fusion proteins expressed in Sf9 membranes bound [³H]TIO according to monophasic saturation curves: hH₂R-G_sS with a K_d value of 32.0 ± 4.6 nM and a B_max value of 0.43 ± 0.02 pmol/mg (SP166); gpH₂R-G_sS with a K_d value of 34.4 ± 8.4 nM and a B_max value of 0.72 ± 0.02 pmol/mg (SP391). Although the K_d values for [³H]TIO fit well to the K_B values for TIO in the GTPase competition studies with HIS (Table 1), we would have expected B_max values of ~5 to 7 pmol/mg for H₂R-G_sS fusion proteins.

View larger version (20K): [in this window] [in a new window]   Fig. 4.   [3H]TIO saturation binding in Sf9 membranes expressing hH2R-GsS and gpH2R-GsS. Membranes expressing hH2R-GsS (A, SP166) or gpH2R-GsS (B, SP391) were incubated in the presence of [3H]TIO at the concentrations indicated on the abscissa as described under Experimental Procedures. Nonspecific binding is the [3H]TIO binding not competed for by 100 µM unlabeled TIO. Specific binding is the difference between total [3H]TIO binding and nonspecific [3H]TIO binding for a given [3H]TIO concentration. Data were analyzed by nonlinear regression and are the means ± S.D. of three experiments performed in duplicate. Similar results were obtained with four other membrane preparations of hH2R-GsS and gpH2R-GsS each.

View this table: [in this window] [in a new window]   TABLE 1 Potencies and inverse agonist efficacies of antagonists at hH2R-GsS and gpH2R-GsS expressed in Sf9 cell membranes KB values for hH2R-GsS and gpH2R-GsS were determined in the GTPase assay. GTP hydrolysis was determined as described under Experimental Procedures. Reaction mixtures contained Sf9 membranes expressing fusion proteins, 1 µM HIS as agonist and antagonists at concentrations from 1 nM to 100 µM to generate saturated competition curves. Competition curves were analyzed by nonlinear regression. To determine the inverse agonist efficacies of antagonists (Inv. Ago. Eff.), the effects of antagonists at a fixed concentration (10 µM) on basal GTPase activity were assessed and referred to the stimulatory effect of 100 µM HIS (= 1.00). Typical basal GTPase activities ranged between ~1 and 2 pmol/mg/min, and typical GTPase activities stimulated by HIS (1 µM) ranged between ~2.5 and 5.0 pmol/mg/min. Data shown are the means of four to five experiments performed in duplicate. Numbers in parentheses represent the 95% confidence intervals. The relative potency (Rel. Pot.) of CIM was set at 100, and the potencies of other antagonists were measured against this value to facilitate comparison of antagonist potencies in the various systems. The effects of compounds at hH2R-GsS were compared with the corresponding effects of compounds at gpH2R-GsS using the t test.

sS

sS

sS

s

s

s

Similar Antagonist Potencies at hH₂R-G_sS and gpH₂R-G_sS Expressed in Sf9 Cell Membranes and Evidence that RAN and APT Differentially Stabilize an Inactive Conformation in H₂R Species Isoforms. In GPCR-G fusion proteins, the GTPase assay is a highly sensitive method to determine ligand potencies and efficacies (Seifert et al., 1999; Milligan, 2000). GTP hydrolysis in Sf9 membranes expressing H₂R-G_sS fusion proteins was stimulated with HIS at a submaximally effective concentration, and the HIS-stimulated GTP hydrolysis was inhibited by H₂R antagonists of various chemical classes. The K_B values for CIM (14), RAN (15), ZOL (16), TIO (17), FAM (18), and APT (19) did not vary by more than a factor of 2 between hH₂R-G_sS and gpH₂R-G_sS (Table 1). We correlated pK_B values of antagonists at hH₂R-G_sS versus gpH₂R-G_sS. If the antagonist-affinities of hH₂R-G_sS and gpH₂R-G_sS were identical, we would expect a linear correlation with a slope of 1.00 that follows the dotted line in Fig. 5A. Indeed, we obtained a highly significant correlation with a slope of 0.98 close to the theoretical curve (Fig. 5A), indicating that the antagonist-binding properties of hH₂R-G_sS and gpH₂R-G_sS are very similar. This is an important finding, because for other GPCR species isoforms, including the H₃R, differences in antagonist-binding properties were observed (Kopin et al., 2000; Ligneau et al., 2000; Lovenberg et al., 2000).

View larger version (20K): [in this window] [in a new window]   Fig. 5.   Relations between pKB values for antagonists and between pD2 values for HIS-like agonists at hH2R-GsS and gpH2R-GsS. pKB values were derived from KB values shown in Table 1. pD2 values were derived from EC50 values shown in Table 2. Solid lines represent the actual correlations obtained. Dashed lines represent the 95% confidence intervals of the correlations. The straight dotted lines represent the theoretical correlations that would have been obtained if pKB values and pD2 values, respectively, had been identical in the two systems compared with each other. The theoretical curves have a slope of 1.00. A, correlation of pKB values for hH2R-GsS versus gpH2R-GsS. Slope, 0.98 ± 0.13; r2, 0.94; p = 0.0015 (significant). B, correlation of pD2 values for agonists 1 to 4 at hH2R-GsS versus gpH2R-GsS. Slope, 0.99 ± 0.13; r2, 0.97; p = 0.0172 (significant).

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sL

sL

sL

sS

sL

Agonist Efficacies, Potencies and Affinities at hH₂R-G_sS and gpH₂R-G_sS Expressed in Sf9 Cell Membranes: Evidence that Guanidines Stabilize an Active Conformation in gpH₂R More Efficiently and Potently Than in hH₂R. We determined the efficacies and potencies of the small H₂R agonists 1 to 4 and of the larger H₂R agonists 5 to 13 in the GTPase assay (Table 2). The efficacies of HIS (1), DIM (2), AMT (3), and BET (4) were similar at hH₂R-G_sS and gpH₂R-G_sS, respectively. In contrast, the efficacies of the guanidines 5 to 13 at hH₂R-G_sS were all significantly lower than at gpH₂R-G_sS. The differences in efficacy were most prominent for BU-E-43 (7), BU-E-48 (10), and D281 (13). Specifically, elongation of the alkyl chain between the guanidino group and the phenyl ring (6  7) and introduction of a bulky Br atom (6  10) or of multiple Cl atoms into the phenyl ring (12  13) had pronounced negative effects on agonist efficacy at hH₂R-G_sS but not at gpH₂R-G_sS. Accordingly, the slope of the correlation of the efficacies of agonists at hH₂R-G_sS and gpH₂R-G_sS was very shallow, and the theoretical curve assuming pharmacological identity of H₂R species isoforms was not approached within the data interval (Fig. 6A). Particularly informative is the comparison of the efficacies of BET (4) and guanidines 8 to 11. At hH₂R-G_sS, these compounds possess efficacies of 0.73 to 0.87, but only guanidines have increased efficacies at gpH₂R-G_sS (Table 2). Taken together, these results indicate that the hH₂R-G_sS and gpH₂R-G_sS conformations stabilized by one of the small agonists 1 to 4 similarly promote GDP/GTP exchange. In contrast, the guanidines 5 to 13 stabilize a hH₂R-G_sS conformation considerably less efficient for GDP/GTP exchange than the corresponding gpH₂R-G_sS conformation.

View this table: [in this window] [in a new window]   TABLE 2 Agonist efficacies and potencies at hH2R-GsS and gpH2R-GsS expressed in Sf9 cell membranes Potencies and efficacies of ligands at hH2R-GsS and gpH2R-GsS were determined in the GTPase assay. GTP hydrolysis was determined as described under Experimental Procedures. Reaction mixtures contained Sf9 membranes expressing fusion proteins and agonists at concentrations from 1 nM to 1 mM as appropriate to generate saturated concentration/response curves. Curves were analyzed by nonlinear regression. Typical basal GTPase activities ranged between ~1 and 2 pmol/mg/min, and typical GTPase activities stimulated by HIS (100 µM) ranged between ~4 and 8 pmol/mg/min. To calculate agonist efficacies, the maximum stimulatory effect of HIS was set at 1.00, and the stimulatory effects of other agonists were referred to this value. Data shown are the means ± SD of four to six experiments performed in duplicate. The relative potency (Rel. Pot.) of HIS was set at 100, and the potencies of other agonists were referred to this value to facilitate comparison of agonist potencies with hH2R-A271D-GsS, NgpChH2R-GsS, and NhCgpH2R-GsS (Table 4). Efficacies and potencies, respectively, of ligands at hH2R-GsS were compared with the corresponding parameters at gpH2R-GsS using the t test.

View larger version (23K): [in this window] [in a new window]   Fig. 6.   Relations between efficacies and potencies of guanidines at hH2R-GsS, hH2R-A271D-GsS, NgpChH2R-GsS and NhCgpH2R-GsS, respectively, versus gpH2R-GsS. Agonist efficacies were taken from Tables 2 and 4, and pD2 values were derived from the EC50 values shown in Tables 2 and 4. Solid lines represent the actual correlations obtained. Dashed lines represent the 95% confidence intervals of the correlations. The straight dotted lines represent the theoretical correlations that would have been obtained if efficacies and pD2 values, respectively, had been identical in the two systems compared with each other. The theoretical curves have a slope of 1.00. A, correlation of efficacies of agonists 5 to 13 at hH2R-GsS versus gpH2R-GsS. Slope, 0.41 ± 0.10; r2, 0.72; p = 0.0038 (significant). B, correlation of pD2 values for agonists 5 to 13 at hH2R-GsS versus gpH2R-GsS. Slope, 0.89 ± 0.32; r2, 0.53; p = 0.0270 (significant). C, correlation of efficacies of agonists 5 to 8, 10, 11, and 13 at hH2R-A271D-GsS versus gpH2R-GsS. Slope, 0.50 ± 0.12; r2, 0.77; p =0.0096 (significant). D, correlation of pD2 values for agonists 5 to 8, 10, 11, and 13 at hH2R-A271D-GsS versus gpH2R-GsS. Slope, 0.81 ± 0.16; r2, 0.83; p = 0.0041 (significant). E, correlation of efficacies of agonists 5 to 8, 10, 11, and 13 at NgpChH2R-GsS versus gpH2R-GsS. Slope, 0.34 ± 0.04; r2, 0.94; p = 0.0003 (significant). F, correlation of pD2 values for agonists 5 to 8, 10, 11, and 13 at NgpChH2R-GsS versus gpH2R-GsS. Slope, 0.67 ± 1.12; r2, 0.07; p = 0.57 (not significant). G, correlation of efficacies of agonists 5 to 8, 10, 11, and 13 at NhCgpH2R-GsS versus gpH2R-GsS. Slope, 0.36 ± 0.06; r2, 0.88; p = 0.0015 (significant). H, correlation of pD2 values for agonists 5 to 8, 10, 11, and 13 at NhCgpH2R-GsS versus gpH2R-GsS. Slope, 0.73 ± 0.28; r2, 0.58; p = 0.0471 (significant).

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

View larger version (23K): [in this window] [in a new window]   Fig. 7.   Competition of [3H]TIO binding by guanidines in Sf9 membranes expressing hH2R-GsS and gpH2R-GsS. [3H]TIO binding in Sf9 membranes was performed as described under Experimental Procedures. Reaction mixtures contained membranes expressing fusion proteins, 10 nM [3H]TIO and agonists at the concentrations indicated on the abscissa. Reaction mixtures additionally contained distilled water (control) or GTPS (10 µM). A and B, IMP (5); C and D, ARP (8); E and F, BU-E-48 (10). Data were analyzed for best fit to monophasic or biphasic competition curves (F test). Data shown are the means ± S.D. of three to five experiments performed in duplicate.

View this table: [in this window] [in a new window]   TABLE 3 Binding properties of guanidines at hH2R-GsS and gpH2R-GsS expressed in Sf9 cell membranes Agonist competition binding was determined as described under Experimental Procedures. The data shown in Fig. 7 were analyzed by nonlinear regression for best fit to monophasic or biphasic competition curves. Data shown are the means of four to six experiments performed in duplicate. Numbers in parentheses represent the 95% confidence intervals. Kh and Kl designate the dissociation constants for the high- and low-affinity state of H2Rs, respectively. %Rh indicates the percentage of high-affinity binding sites. The corresponding values obtained in the presence of GTPS (10 µM) are referred to as KhGTPS, KlGTPS and %RhGTPS, respectively. If data were best fit to monophasic competition curves, data are listed under Kl and KlGTPS, respectively.

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

Molecular Analysis of Guanidine/H₂R Interactions. The crystal structure of bovine rhodopsin (Palczewski et al., 2000) has improved the reliability of GPCR models with bound ligands. To elucidate the structural basis for the differences in interactions of guanidines with H₂R species isoforms, we built three-dimensional models of the seven TM helices of gpH₂R starting from the PDB rhodopsin file 1f88 and using the alignment with the ₂AR (Palczewski et al., 2000). Additionally, our previous 3D QSAR data obtained by comparative molecular field analysis, correlating pD₂ values of guanidines at gpH₂R-atrium with electrostatic and steric field variables, were considered (Dove and Buschauer, 1998, 1999), in particular for defining the conformation and superposition of structures.

View larger version (131K): [in this window] [in a new window]   Fig. 8.   Model of the interaction of IMP with the gpH2R. The carbon atoms of IMP (5) are shown in green. Side chains and -carbon atoms of the putative agonist-binding site and at the top of TM1 and TM7 are drawn. A, view into the GPCR core; B, lateral view. The imidazolylpropylguanidine moiety interacts with Asp-98 in TM3 (Gantz et al., 1992) and the Tyr-182/Asp-186 pair in TM5 (Nederkoorn et al., 1996). Asn-293 of the 2AR (Wieland et al., 1996) and Phe-436 of the H1R (Wieland et al., 1999) have been suggested to interact with the -OH group of epinephrine and with the imidazolylethyl side chain of HIS, respectively. The corresponding residue of the H2R, Phe-254, is close to the imidazolylpropyl side chain only if agonists do not deeply penetrate into the GPCR core. Major differences in amino acid sequence between hH2R and gpH2R occur on the top of TM1 and TM7. The gpH2R model proposes H-bonds of Asp-271 (hH2R: Ala-271) in TM7 to the N hydrogen of the 5-methyl-1H-imidazol-4-yl group of IMP and to the OH group of Tyr-17 (hH2R: Cys-17) in TM1. Because of the different amino acid substitutions in hH2R, these H-bonds are not possible in this GPCR.

View larger version (133K): [in this window] [in a new window]   Fig. 9.   Model of the interaction of ARP with the gpH2R. The carbon atoms of ARP (8) are shown in orange. Side chains and -carbon atoms of the putative agonist-binding site and at the top of TM1 and TM7 are drawn. A, view into the GPCR core; B, lateral view. For description of the binding of the imidazolylpropyl moiety, see Fig. 8. Asp-271 (hH2R: Ala-271) in TM7 again forms an H-bond to the OH group of Tyr-17 (hH2R: Cys-17) in TM1. For most favorable interaction with the H2R, the pyridyl- and the phenyl group must be arranged as shown. Attempts to roughly exchange the position of both rings by rotation of the propyl side chain bonds either resulted in high-energy conformations or in collision with the helices. Significantly different QSAR with respect to substituents at the phenyl ring of derivatives of ARP (8) and of unbranched phenyl as well as benzylthioalkyl compounds, respectively, suggest that the aryl or heteroaryl ring of structures such as IMP must be superimposed with the pyridyl ring of the pyridylphenylpropyl analogs. In particular, bulk is unfavorable for potency around the "pyridyl site" and allowed in meta and para position of the "phenyl site". This agrees with a model where the latter site points outside the GPCR core. The suggested binding mode of the "pyridyl site" of ARP derivatives further considers that 2- and 3-pyridylphenylpropyl structures are on average 0.3 to 0.4 pD2 units more potent than the corresponding diphenyl analogs. The model in Fig. 9 assumes the pyridyl group of ARP to be surrounded by a pocket of the aromatic residues Tyr-78, Tyr-94, Trp-275, and Tyr-278, where ligand bulk is restricted. Corresponding to Tyr-78, His-93 of the 2AR is probably involved in the binding of the p-methoxy group of formoterol (Isogaya et al., 1999). One of these hydrogen-donating aromatic residues might form an H-bond with the pyridyl nitrogen of ARP, but the model rather suggests an ion-dipole interaction of Asp-271 with a positively charged region of the pyridyl group. Studies with 2AR mutants (Isogaya et al., 1999) point to an interaction of Tyr-308, corresponding to Glu-270 in H2Rs, with the arylalkyl side chain of formoterol. In the gpH2R model, a salt bridge between Glu-270 and Arg-257 (TM6) positions both side chains for additional interaction with the phenyl moiety of ARP. In agreement with our 3D QSAR studies, indicating favorable effects of negatively charged meta and para substituents, ion-dipole interactions or, as anticipated in the case of ARP, a F---HN H-bond with Arg-257 could be possible. The field effect of Arg-257 might additionally amplify interactions of Glu-270 with positively charged phenyl regions.

sS

s

s

s

s

View larger version (39K): [in this window] [in a new window]   Fig. 10.   Analysis of the expression of hH2R-A271D-GsS, NgpChH2R-Gs and NhCgpH2R-Gs fusion proteins in Sf9 cell membranes. A, schematic structures of hH2R-A271D-GsS, NgpChH2R-Gs and NhCgpH2R-Gs fusion proteins. For precise location of the KpnI site used for construction of chimeras, see Fig. 2. Sf9 cell membranes expressing various H2R-Gs fusion proteins or membranes from uninfected Sf9 cells were separated by SDS-PAGE using a gel that contained 8% (w/v) acrylamide. Fusion proteins were probed with the anti-FLAG Ig (M1 antibody) (B) or the anti-Gs Ig (C). For each membrane preparation, 100 µg of protein was applied to each lane. Numbers on the left of the immunoblots indicate molecular masses of marker proteins. Shown are the horseradish peroxidase-reacted Immobilon P membranes of representative gels. Similar results were obtained with two other membrane preparations of hH2R-A271D-GsS, NgpChH2R-Gs, and NhCgpH2R-Gs fusion proteins.

sS

sS

sS

sS

sS

sS

sS

sS

s

sS

sS

s

s

s

s

s

sL

s

s

s

s

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

View this table: [in this window] [in a new window]   TABLE 4 Agonist efficacies and potencies at hH2R-A271D-GsS, NgpChH2R-GsS, and NhCgpH2R-GsS expressed in Sf9 cell membranes Potencies and efficacies of ligands at hH2R-A271D-GsS, NgpChH2R-GsS, and NhCgpH2R-GsS were determined in the GTPase assay. GTP hydrolysis was determined as described under Experimental Procedures. Reaction mixtures contained Sf9 membranes expressing fusion proteins and agonists at concentrations from 1 nM to 1 mM as appropriate to generate saturated concentration/response curves. Curves were analyzed by nonlinear regression. Typical basal GTPase activities ranged between ~1 and 2 pmol/mg/min, and typical GTPase activities stimulated by HIS (100 µM) ranged between ~4 and 8 pmol/mg/min. To calculate agonist efficacies, the maximum stimulatory effect of HIS was set at 1.00, and the stimulatory effects of other agonists were referred to this value. Data shown are the means ± S.D. of three to six experiments performed in duplicates. The relative potency (Rel. Pot.) of HIS was set at 100, and the potencies of other agonists were referred to this value to facilitate comparison of agonist potencies with hH2R-GsS and gpH2R-GsS (Table 2).

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

sS

	Conclusions

Top Abstract Introduction Experimental Procedures Results and Discussion Conclusions References

In previous studies we observed that several guanidine-type H₂R agonists are less potent and/or less efficient at the H₂R of human neutrophils than at the H₂R of the guinea pig atrium (Burde et al., 1989, 1990; Buschauer, 1989). Taking advantage of the cloned hH₂R and gpH₂R (Gantz et al., 1991; Traiffort et al., 1995) and the GPCR-G fusion protein technique (Seifert et al., 1999; Milligan, 2000) we were able to analyze the coupling of hH₂R and gpH₂R to G_sS under identical experimental conditions. Using this approach, we have dissected pharmacological differences between hH₂R and gpH₂R with respect to the inverse agonist efficacies of RAN (16) and APT (19) and the agonist potencies and efficacies of guanidines 5-13. Thus, our present data clearly show that hH₂R and gpH₂R possess, indeed, different pharmacological properties.

Guanidines stabilize an active conformation in gpH₂R more efficiently and potently than in hH₂R. Site-directed mutagenesis studies and analysis of chimeric hH₂R/gpH₂R receptors confirmed computer modeling proposing that Asp-271 accounts for the high potency of guanidines. The gpH₂R model also suggests that high guanidine efficacy depends on an H-bond between Asp-271 and Tyr-17 that is not possible in any other H₂R-G_s construct studied. Thus, our data show that hH₂R and gpH₂R selectively interact with a single class of synthetic agonists, that high guanidine potency critically depends on interaction with a single single amino acid, and that agonist potency and efficacy are regulated independently of each other. The inverse order of potency of compounds 6 and 7 at hH₂R and gpH₂R, respectively, indicates that it is possible to develop guanidines with potency at hH₂R. Such compounds may be useful for treating cardiac failure, acute myelogenous leukemia, and inflammatory diseases.

Our present study adds the H₂R to the growing list of GPCR species isoforms that interact similarly with their endogenous ligand, but quite differently with synthetic ligands (Kopin et al., 2000; Ligneau et al., 2000; Lovenberg et al., 2000). Many GPCR species isoforms, including the H₃R, differ from each other primarily in antagonist pharmacology (Kopin et al., 2000; Ligneau et al., 2000; Lovenberg et al., 2000). From a historical perspective, it is very fortunate that the pharmacological differences between hH₂R and gpH₂R mainly concern agonists and not antagonists (Fig. 5). Otherwise, it would have been much more difficult if not impossible to develop potent H₂R antagonists for treatment of gastroduodenal ulcer disease in man relying on animal models at a time when recombinant hH₂R had not yet been available. However, for future development of potent and selective H₂R agonists it will be crucial to analyze hH₂R and not gpH₂R.