|
|
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
-Helix Domain 7 of the AT1 Receptor Induce Promiscuous Agonist Specificity for Angiotensin II Fragments: A Pseudo-Constitutive Activity
Department of Pharmacology, Uniformed Services University of the Health Sciences, Bethesda, Maryland (Y.-H.F., R.Q.); and Department of Medicine, CWRU School of Medicine, Cleveland, Ohio (L.Z., R.Z.)
Received February 1, 2005; accepted May 17, 2005
| Abstract |
|---|
|
|
|---|
AT1 receptors are GPCRs that mediate the actions of Ang II, an octapeptide hormone that regulates blood pressure, homeostasis, and cell growth (Feng and Douglas, 2000
). Stimulation of AT1 receptors leads to G
q/11-mediated activation of phospholipase C
1, generating diacylglycerol and inositol 1,4,5-triphosphate. Although naturally occurring constitutively active AT1 mutants are not known, engineered mutations of Asn111 to Gly111, Ala111, and Ser111 have displayed constitutive activities through a mechanism that mimics the Ang II-induced activation (Noda et al., 1996
; Balmforth et al., 1997
; Groblewski et al., 1997
; Feng et al., 1998
). Other engineered mutations of N295S and L305Q were also reported to be constitutively active in HEK293 cells (Balmforth et al., 1997
; Parnot et al., 2000
). However, the constitutive activities of N295S and L305Q observed in HEK293 cells surprisingly disappeared in COS-1 and COS-7 cells (Feng et al., 1998
; Hunyady et al., 1998
). It seems that cell type does not explain the complete loss of constitutive activities, because the constitutive activity of N111G did not disappear in COS cells. This suggests that N295S and L305Q may differ from N111G in constitutive activity because of unidentified intrinsic properties. If so, would N295S and L305Q also differ from N111G in agonist specificity?
Ang II consists of eight residues (Asp1-Arg2-Val3-Tyr4-Ile5-His6-Pro7-Phe8). The residues Tyr4 and Phe8 are considered agonist switches because they are essential for agonism of the wild-type AT1 receptors (Noda et al., 1996
; Feng et al., 1998
; Miura et al., 1999
). The other residues of Ang II are necessary for stabilization of AT1 receptor conformation. Thus, [Sar1,Ile4,Ile8]Ang II, an analog of the potent full agonist [Sar1]Ang II, is incapable of activation of wild-type AT1 receptors, whereas [Sar1,Ile4]Ang II and [Sar1,Ile8]Ang II are partial agonists (Noda et al., 1996
; Feng et al., 1998
; Miura et al., 1999
).
In this study, various measures (i.e., Ang II analogs and low Na+ concentrations) were used to further investigate the reason why the increased basal activities of N295S and L305Q in HEK293 cells disappear in COS cells and to examine whether these mutations alter agonist specificity for Ang II and its native fragments. This work shows that the increased basal activity of N295S and L305Q in HEK293 cells was caused by the presence of endogenous Ang II fragments produced by the cellsa pseudo-constitutive activity. It is surprising that these mutations induced promiscuous activation of the mutant AT1 receptors by Ang II and its native fragments.
| Materials and Methods |
|---|
|
|
|---|
Mutagenesis and Expression of the AT1 Receptors. The synthetic rat AT1 receptor gene with a consensus Kozak sequence at the N terminus and an 1D4 epitope tag (TETSQVAPA) at the C terminus, cloned in the shuttle expression vector pMT-3, was used for expression and mutagenesis, as described previously (Noda et al., 1996
; Feng et al., 1998
; Miura et al., 1999
). AT1 mutants were prepared with the restriction fragment-replacement method and the polymerase chain reaction method as described previously (Noda et al., 1996
; Feng et al., 1998
; Miura et al., 1999
). The DNA sequence analysis was performed by Cleveland Genomics Inc. to confirm the mutations. To express the AT1 receptor protein, 3 µg of plasmid DNA/107 cells was column-purified and used in transfection (columns from QIAGEN, Valencia, CA). COS-7 and HEK293 cells (American Type Culture Collection) were transfected with the Gene-PORTER transfection reagents (Genlantis, San Diego, CA). Transfected cells cultured for 48 h were harvested and Mg2+-free cell membranes were prepared by the nitrogen Parr cell disruption bomb method (Feng et al., 1998
). In brief, after centrifugation of the cell membrane homogenate at 30,000g [14,400 rpm with an SA-600 rotor (Sorvall, Newton, CT) for 15 min], the pellet was resuspended in 5 ml of HEPES/EDTA buffer (50 mM HEPES, pH 7.4, and 1.5 mM EGTA, containing protease inhibitors) and re-centrifuged at 30,000g for 15 min. Finally, the pellet (crude membrane fraction) was resuspended in 1.0 ml of HEPES/EDTA containing 10% glycerol (per 108 cells). The membrane fraction was aliquoted into 1.5-ml Eppendorf tubes and stored at -70°C. The receptor expression was assessed in each case by immunoblot analysis (data not shown) and by 125I-[Sar1,Ile8]Ang II saturation binding analysis.
Ligand Binding Study. 125I-[Sar1,Ile8]Ang II binding experiments were carried out under equilibrium conditions as described earlier (Noda et al., 1996
; Feng et al., 1998
; Miura et al., 1999
). For competition binding studies, membranes expressing the wild-type (WT) or mutant receptors were incubated for 1 h with 0.3 nM 125I-[Sar1,Ile8]Ang II and various concentrations of the ligands in assay buffer. The Kd value of 125I-[Sar1,Ile8]Ang II was determined by competition binding study in the presence of various concentrations (0.03 to 3 nM) of 127I-[Sar1,Ile8]Ang II. For the saturation binding study, increasing concentrations of 125I-[Sar1,Ile8]Ang II that was 10-fold higher than the Kd value of the receptor were used to obtain >90% bound form of the receptor. Nonspecific binding (which was <5% of total binding in our experiments) of the 0.3 nM 125I-[Sar1,Ile8]Ang II radioligand to the membrane was measured in the presence of 50 µM 127I-[Sar1,Ile8]Ang II. All binding experiments were carried out at 22°C for 1 h in a 250-µl volume unless otherwise indicated. After equilibrium was reached, the binding reactions were stopped by filtering the binding mixture under vacuum (Brandel Type M-24R) through FP-200 GF/C glass fiber filters (Whatman Inc., Clifton, NJ). The filters were extensively washed further with ice-cold binding buffer to wash away the free radioligand. The bound ligand fraction was determined from the counts per minute remaining on the membrane. Equilibrium-binding kinetics were determined using the computer program Ligand. The Kd values represent the mean ± S.E. of three to five independent determinations.
Production of Total Inositol (1,4,5)Phosphates. COS-7 and HEK293 cells were cultured in Dulbecco's modified Eagle's medium containing 10% bovine calf serum. The medium for HEK293 cells contains 1% nonessential amino acids. Twenty-four hours after transfection, COS-7 and HEK293 cells cultured in 60-mm Petri dishes were labeled for 24 h with [myo-3H]inositol (1µCi/ml) at 37°C in inositol-free Dulbecco's modified Eagle's medium containing 10% bovine calf serum. On the day of IP assay (i.e., 48 h after transfection), the labeled cells were washed three times with serum-free medium and incubated with their specific media containing 10 mM LiCl for 20 min. Then, medium alone or ligands were added to the cells. After incubation for 45 min at 37°C, the medium was removed, and total soluble IP was extracted from the cells by the perchloric acid extraction method as described previously (Noda et al., 1996
; Feng et al., 1998
; Miura et al., 1999
). The amount of [3H]IP eluted from the column was counted, and a concentration-response curve was generated using iterative nonlinear regression analysis (Noda et al., 1996
; Feng et al., 1998
; Miura et al., 1999
). To determine the total IP under low Na+ conditions, cells were incubated before the experiment for 15 min in incubation buffer (138 mM NaCl, 5 mM KCl, 10 mM LiCl, 1 mM CaCl2, 1 mM MgCl2, and 10 mM Na+-HEPES, pH 7.2) or in incubation buffer where 138 mM Na+ had been substituted by 138 mM N-methyl-D-glucamine (Sigma, St. Louis, MO). This treatment has been shown to greatly decrease the intracellular Na+ content because of the presence of Na+/K+-ATPases in all nucleated mammalian cells (Glossmann et al., 1974
; Tsai and Lefkowitz, 1978
; Ceresa and Limbird, 1994
; Quitterer et al., 1996
).
Measurement of AT1 Receptor Internalization. Internalization of the AT1 receptors was measured by a method described earlier (Thomas et al., 2000
). In brief, cells transiently transfected with AT1 receptors in 12-well plates were stimulated with and without Ang II (100 nM) or [Sar1,Ile4,Ile8]Ang II (1 µM for N111G and 30 µM for other receptors) for 10 min at 37°C. Surface-bound ligands were removed by gentle acid wash (50 mM sodium citrate, 0.2 mM sodium phosphate, 90 mM NaCl, and 0.1% bovine serum albumin, pH 5.0; 10 min at 4°C), which does not affect subsequent receptor binding. Then, a radioligand binding assay was performed (5 h at 4°C) to measure receptors remaining at the cell surface. Internalized receptors were expressed as a percentage loss of cell surface binding compared with cells not exposed to Ang II or [Sar1,Ile4,Ile8]Ang II.
RT-PCR of Angiotensinogen. Total RNA from HEK293 and COS-7 cells were prepared with an RNAeasy kit (Invitrogen, Carlsbad, CA) and used for routine reverse transcriptase and polymerase chain reaction (RT-PCR) with an RT-PCR kit (Invitrogen). The primers used for amplification of angiotensinogen transcripts were: forward, gctgatccagcctcactatg; and reverse, gctgttgggtagactctgtg. Sequence analysis indicated that these primers should recognize the transcripts of humans (HEK293 cells) and monkeys (COS-7 cells). The expected sizes of PCR products are 308 base pairs for angiotensinogen.
Enzyme Immunoassay of Ang II and Its Fragments. All cells at approximately 90% confluence in 60-mm dishes were washed carefully three times and then cultured with 2 ml of serum-free media containing cocktail protease inhibitors in a cell culture incubator. Six hours after culture, the 2 ml of media were collected and microcentrifuged at full speed to remove cell debris. The levels of endogenous angiotensin peptides in the media were measured with the enzyme immunoassay kit (SPI-BIO) following the company's protocol. The antibody of this kit cross-reacts with Ang I, Ang II, Ang III, and Ang IV but not with Ang 1-7 and other nonangiotensin peptides. Thus, it measures a mixed level of Ang II and its fragments.
Statistical Analysis. The results are expressed as the mean ± S.E.M. of three to five independent determinations. The significance of measured values was evaluated with an unpaired Student's t test.
| Results |
|---|
|
|
|---|
4-fold) and [Sar1,Ile4,Ile8]Ang II (
3-fold) and significantly decreased binding affinities for nonpeptide inverse agonist EXP3174 (24-fold) compared with the wild-type AT1 receptor. The patterns of increase or decrease of binding affinities are similar to those of constitutively active mutant N111G although the magnitude varies (Fig. 1). The binding affinities of N295S and L305Q for [Sar1]Ang II are not significantly increased compared with the wild-type AT1 receptor.
|
The Elusive Constitutive Activities of N295S and L305Q. To compare the basal activities of the receptors in HEK293 cells and COS-7 cells, we optimized the transfection protocol by varying the amount of plasmid DNAs. With the amount of DNA shown in Table 1, comparable expression levels (similar Bmax values for all receptors in the two type of cells) of the receptors on the cell surface were achieved and used for the IP production assay. Table 1 also shows the absolute amount of IP production. The maximal IP productions induced by 5 µM [Sar1]Ang II demonstrate no significant differences for N295S and L305Q compared with the wild-type AT1 and N111G. For basal IP productions, no significant differences were observed for N295S and L305Q compared with the wild type, except in HEK293 cells.
|
The basal IP activities of all four receptors were significantly higher in HEK293 cells than in the COS-7 cells. When basal IP productions were expressed as percentage of maximal activities of the wild-type AT1 receptors in the presence of 5 µM [Sar1]Ang II for a specific cell type, the constitutive activities of the wild-type, N111G, N295S, and L305Q in HEK293 cells were 3, 48.7, 18.4, and 6%, respectively. These constitutive activities are 16.3-, 6.1-, and 2-fold greater, respectively, than that of the wild-type receptor. It is surprising that the 18.4 and 6% basal IP produced by N295S and L305Q disappeared in COS-7 cells. Their basal IP productions in the COS-7 cells fell into the range of the wild type and mock (Table 1). However, the basal IP of N111G remained significantly higher than the wild type (around 31.2% in COS-7 cells). The N111G also induced significantly higher production of basal IP in HEK293 cells than in the COS-7 cells (48.7 versus 31.2%). Wild-type AT1 also induced higher basal IP in HEK293 cells than in the COS-7 cells (Table 1), similarly to N111G.
Increased IP Activities of N295S and L305Q in COS-7 Cells in the Presence of Conditioned Media of HEK293 Cells. Because HEK293 cells also displayed higher basal IP than the other types of cells for the wild-type receptor (Table 1), we thought that HEK293 cells might produce a trace amount of endogenous angiotensin II attributable to the increased basal IP activities of the wild-type, N111G, N295S, and L305Q receptors. To test this hypothesis, the COS-7 cells expressing N295S, L305Q, and wild-type receptors were stimulated with the conditioned media of HEK293 cells, and the basal IP productions were measured for the receptors. It is interesting that the conditioned media induced 16.3, 7.4, and 4.5% basal IP productions for N295S, L305Q, and the wild type. These IP productions were significantly greater compared with the control media (Fig. 2). These results suggest that HEK293 cells may produce native angiotensin peptides to activate the receptors.
|
|
Promiscuous Activation of N295S and L305Q by Ang II Analog and Endogenous Ang II Fragments. As shown in Fig. 4A, an inactive Ang II analog [Sar1,Ile4,Ile8]Ang II that is completely incapable of activating the wild-type receptor activated mutant N295S and L305Q. Stimulation of N295S and L305Q using 50 µM [Sar1,Ile4,Ile8]Ang II produced maximal IP productions that were equivalent to the maximal activity of the wild-type receptor in the presence of 0.1 µM [Sar1]Ang II. This observation was highly reproducible and consistent regardless of the cell types tested in the study. However, [Sar1,Ile4,Ile8]Ang II at such a high concentration failed to activate the wild-type receptor. When the maximal IP production of the wild type in the presence of 0.1 µM [Sar1]Ang II was taken as a reference for 100%, [Sar1,Ile4,Ile8]Ang II exerted an equivalent efficacy but reduced potency in inducing IP production by N295S and L305Q compared with the N111G mutant. This was demonstrated by the shift of the curves to the right-hand side (Fig. 4A).
|
To examine whether native Ang II fragments also activate the mutants N295S and L305Q, we measured IP productions for these mutants in the presence of Ang IV, Ang 1-7, and Ang 5-8 peptide fragments that are completely incapable of activating wild-type AT1 receptors. As shown in Fig. 4B, peptides Ang IV, Ang 1-7, and Ang 5-8 became either full agonists (Ang IV) or partial agonists (Ang 1-7 and Ang 5-8) for these mutant receptors. Ang I, a partial agonist of wild-type AT1, became a full agonist for all three mutants (data not shown). A peptide (HDIFPVYR) with randomized sequence of Ang II failed to activate any mutant at concentrations of
5 µM (data not shown). Activations of the mutant receptors by these Ang II fragments were independent of cell types.
Differential Increases in Basal Activity of AT1 Receptors by Lowering Na+ Concentration. Lowering the intracellular Na+ concentration has been shown to increase the basal activity of the bradykinin B2 receptor independently of agonist binding (Glossmann et al., 1974
; Tsai and Lefkowitz, 1978
; Quitterer et al., 1996
). Na+ has also been shown to alter Ang II binding affinity as well (Glossmann et al., 1974
). To test whether mutant N295S and L305Q are more similar to the wild-type or constitutively active N111G in the absence of any ligand, the COS-7 cells were cultured under a low-sodium condition (10 mM) as described under Materials and Methods. The absolute constitutive activities of N295S (42.6%) and L305Q (51.5%) at 10 mM Na+ condition in COS-1 cells increased substantially to levels near that of the N111G (48.8%) (Fig. 5A). The basal IP productions under 10 mM Na+ condition increased 11-fold for N295S and L305Q, but only 2- and 1.6-fold for the wild type and N11G, respectively, compared with that under the 148 mM normal sodium condition. The -fold changes in basal IP induced by N295S and L305Q were significantly greater (>5-fold) than the -fold change by the wild type and N111G. The low-sodium condition (10 mM) also increased efficacy of [Sar1]Ang II in maximal IP for N111G (16.5%), N295S (16.3%), and L305Q (15.9%) but not for the wild-type receptor in COS-7 cells.
|
2-adrenergic receptors (Ceresa and Limbird, 1994
Inverse Agonist and Internalization of N295S and L305Q. Because inverse agonists block the constitutive activity of N111G (Noda et al., 1996
; Feng et al., 1998
), they may also inhibit the increased basal activities of mutants N295S and L305Q observed under low-Na+ conditions. To test this hypothesis, EXP3174 and candesartan, the specific inverse agonists of AT1 receptor, were added to the cells at the same time as the low-Na+ condition was applied. It is striking that EXP3174 and candesartan inhibited the increment in basal IP production to approximately 90 and 85%, respectively, for N295S and 68 and 70%, respectively, for L305Q, whereas the specific neutral antagonist Losartan failed to inhibit the basal activity as shown in Fig. 5B.
It was reported that Ang II but not [Sar1,Ile4,Ile8]Ang II induced internalization of the wild type and the constitutively active N111G (Thomas et al., 2000
). To test whether N295S and L305Q are different from the wild type or N111G in internalization, Ang II and [Sar1,Ile4,Ile8]Ang II were used. The result showed that Ang II induced a wild-type-like internalization profile for N295S and L305Q receptors in COS-7 cells. Similar to the wild type and N111G, the two mutant receptors also failed to respond to [Sar1,Ile4,Ile8]Ang II in internalization. Thus, N295S and L305Q was not different from the wild type in internalization in COS-7 cells when stimulated with Ang II and [Sar1,Ile4,Ile8]Ang II.
| Discussion |
|---|
|
|
|---|
In this study, we have found that the previously reported constitutive activity of N295S and L305Q results from the endogenous Ang II and its fragments produced by the HEK293 cells. Because the enzyme immunoassay kit used in the study also detects other Ang II fragments (including Ang I, Ang III, Ang IV, and Ang 5-8), the exact amount of Ang II produced in the cell medium remains unknown. It is possible that Ang II, the active hormone, is not the major form of angiotensin peptide produced by the HEK293 cells because the wild-type AT1 receptor produced only minimal amounts of basal activity in HEK293 cells. The basal activities increased in N295S and L305Q over the wild-type in HEK293 cells (6.2- and 2-fold, respectively; Table 1) are probably caused by increased Ang II affinity and the presence of other Ang II fragments. This prompted us to further examine whether inactive Ang II fragments activate N295S and L305Q.
The inactive angiotensin II fragments used in this study are naturally occurring short peptides. Ang 1-7 and Ang IV are native agonists for their own specific receptors (Albiston et al., 2001
; Santos et al., 2003
). Ang 5-8 has no known function. These inactive Ang II fragments plus active hormone Ang II, Ang I, and Ang III all activate N295S and L305Q, whereas only Ang I, Ang II, and Ang III activate the wild-type AT1 receptor. In addition, [Sar1,Ile4,Ile8]Ang II activates N295S and L305Q as it activates N111G. Moreover, N295S and L305Q induce a much greater -fold-increase in basal activity than N111G and the wild-type receptor under low-Na+ conditions. Thus, N295S and L305Q are distinct from the wild-type receptor and similar to the constitutively active mutant N111G receptors in properties of promiscuous activation by structurally similar peptides. However, N295S and L305Q are not constitutively active by definition because they show no detectable basal activity in the absence of ligand.
|
Activation of GPCRs can occur through agonist-dependent as well as agonist-independent spontaneous mechanisms. Like other GPCRs, the molecular mechanism involved in AT1 receptor activation remains unclear (Noda et al., 1996
; Feng et al., 1998
; Miura et al., 1999
; Feng and Douglas, 2000
; Boucard et al., 2003
; Hunyady et al., 2003
; Karnik et al., 2003
; Martin et al., 2004). In light of recent discovery of constitutively active mutations, the extended ternary complex model (Kjelsberg et al., 1992
; Lefkowitz et al., 1993
; Gether and Kobilka, 1998
), the two-state model (Leff, 1995
), and the cubic ternary model (Weiss et al., 1996
; Gether and Kobilka, 1998
) have been proposed to describe GPCR activation. These models suggest that GPCRs exist in an equilibrium of two functionally distinct states, inactive (R) and active (R*).
Karnik's laboratory (Noda et al., 1996
; Feng et al., 1998
) proposed that constitutively active mutant receptors may exist in partial active states (R'). This model explains the constitutive activity for N111G. It also explains why the inactive Ang II analog, [Sar1,Ile4,Ile8]Ang II, drives N111G to its fully active R* state. Our data suggest that mutant N295S and L305Q receptors may have overcome most energy barriers and exist in a neutral state (RN) or a state proximal to RN states (Fig. 6). The RN state is relatively stable so that no basal activity will be produced because additional stabilization energy is required to drive the conformation to either the R or R* direction. An inverse agonist would drive the RN to the R state, whereas an agonist or a partial agonist would drive the RN to the R* or R' state. The N295S and L305Q receptors in the RN state no longer require the agonism-specifying side chains of Ang II that are normally required for the wild type to overcome the energy barrier to remove the structural constraints. However, they do require certain stabilization energy to "trap" the conformation to R' or R* for effector activation. The naturally occurring inactive Ang II fragments and synthetic inactive Ang II analog [Sar1,Ile4,Ile8]Ang II are actually agonists or partial agonists to N295S and L305Q because they activate the receptors.
Asn295 and Leu305 are located in a region of TM7 that is not thought to interact directly with Ang II (Fig. 7). Mutations at these positions resulted in new selectivity or promiscuous agonist specificity for Ang II fragments, similar to constitutively active N111G (Le et al., 2002
). These mutations barely affect the receptor internalization, as shown in the internalization study, suggesting little possibility of a modified basal activity through alteration of the internalization. TM7 of the AT1 receptor plays a pivotal role in the receptor activation. An interaction between TM2 Asp74 and TM7 Tyr292 was proposed in an earlier model (Marie et al., 1994
). Most recently, Karnik's laboratory reported interactions involving an extensive hydrogen bonding network (Asn69-Tyr302, Asp74-backbone carbonyl of Asn294 and Asn295, Asp74-water-Asn298, and Thr80-Tyr292) between TM2 and TM7 (Miura et al., 2003
). Boucard et al. (2003
) reported that TM7 goes through a pattern of helical movements upon the receptor activation, suggesting an interhelical network interaction involving Asn111-Asp74-Asn298 among TM3, TM2, and TM7. Removal of constraints through agonist or mutation by breaking the interhelical interaction network and inducing TM movements may explain receptor activation and the constitutive activity of N111G (Boucard et al., 2003
; Miura et al., 2003
; Martin et al., 2004). N295S and L305Q may have resulted in conformational changes similar to those in N111G, leading to pseudo-constitutive activity or RN state with promiscuous agonist specificity. Mutations of N295S and L305Q must have generated new interhelical interaction networks with little constraints preventing the receptors from full activation. However, the exact new interhelical interaction network generated by point mutations in N295S and L305Q is not known at this time.
|
The small but significant basal activity (8.73%) of D74G at low Na+ concentrations indicates that the highly conserved Asp74 is not the only factor that mediates the Na+ effects. Lowering the Na+ concentration could overcome a weak constraint in D74G, leading to 8.73% basal activity. It is also possible that N295S and L305Q still possess a weak constraint and that a certain degree of energy is needed to overcome this barrier. Likewise, lowering the Na+ concentration could overcome this weak constraint in N295S and L305Q, leading to much greater basal activities on the basis of mutations.
Since its first use in Dr. Karnik's laboratory, the inactive Ang II analog [Sar1,Ile4,Ile8]Ang II has been used in many studies to characterize AT1 receptors (Noda et al., 1996
; Thomas et al., 2000
; Holloway et al., 2002
; Wei et al., 2003
; Ahn et al., 2004a
,b
). Although this Ang II analog induces no IP production, it has been shown to induce phosphorylation (Thomas et al., 2000
; Holloway et al., 2002
) and Erk1/2 activation through binding to the wild-type AT1. Consistent with our observation concerning activation of N295S and L305Q, [Sar1,Ile4,Ile8]Ang II should be considered a partial agonist for the wild type. It is quite possible that this analog still contains an agonism-specifying side chain or group required for AT1 activation. The power of this agonism-specifying side chain or group may be very weak but clearly critical and sufficient for induction of a distinct conformation required for Erk1/2 activation and the receptor phosphorylation. It may also be sufficient to overcome the minimal energy barrier in N295S and L305Q as revealed at low Na+ concentration.
Inhibition of basal activity by receptor-specific inverse agonist is a hallmark of constitutively active receptors (Bond et al., 1995
; Noda et al., 1996
; Groblewski et al., 1997
; Leurs et al., 1998
). EXP3174 is an inverse agonist that has been shown to inhibit basal activity of the wild-type AT1 and constitutively active mutant N111G (Noda et al., 1996
). For the mutants with pseudoconstitutive activity, EXP3174 exhibited similar inhibitory actions at low Na+ concentrations. This is different from the observations employing three nonpeptide antagonists (WIN64338 WIN51556 and NPC18325 of bradykinin B2 receptors (Quitterer et al., 1996
). However, it is not clear whether these antagonists are inverse or partial agonists or neutral antagonists.
In summary, this study identified a novel pattern of mutation that traps the receptor at the RN state with a remarkably extended spectrum of agonist specificity. Although an agonist-mediated conformational selection model for GPCR activation has been proposed (Kjelsberg et al., 1992
; Lefkowitz et al., 1993
; Leff, 1995
; Noda et al., 1996
; Gether and Kobilka, 1998
), most GPCRs (i.e., rhodopsin and
2-adrenergic receptor) are found to be activated through an agonist-mediated conformational induction model (Karnik et al., 2003
). In fact, GPCRs activated through the conformational selection model are very scarce at this time. Our data may suggest the possible existence of GPCRs in nature that can be activated by agonists through a conformational selection mechanism.
| Acknowledgements |
|---|
| Footnotes |
|---|
ABBREVIATIONS: GPCR, G protein-coupled receptor; TM, transmembrane
-helix domain; HEK, human embryonic kidney; IP, inositol 1,4,5-triphosphate; RT-PCR, reverse transcription-polymerase chain reaction; EXP3174, 2-butyl-4-chloro-1-((2'-(1H-tetrazol-5-yl)(1,1'-biphenyl)-4-yl)methyl)-1H-imidazole-5-carboxylic acid; Ang I, angiotensin I (Asp1-Arg2-Val3-Tyr4-Ile5-His6-Pro7-Phe8-His9-Leu10); Ang II, angiotensin II (Asp1-Arg2-Val3-Tyr4-Ile5-His6-Pro7-Phe8); Ang IV, angiotensin IV (Val3-Tyr4-Ile5-His6-Pro7-Phe8); Ang 1-7, angiotensin 1-7 (Asp1-Arg2-Val3-Tyr4-Ile5-His6-Pro7); Ang 5-8, angiotensin 5-8 (Ile5-His6-Pro7-Phe8); WIN64338 [4-[[2[[bis(cyclohexylamino) methylene]amino]-3-(2-naphthalenyl)-1-oxopropyl]amino]phenyl]methyl]tributyl phosphonium chloride HCl; NPC18325 D-Arg1-Arg2-[aminotridecanoyl]3-Ser4-D-Tic5-Oic6+++-Arg7.
Address correspondence to: Dr. Ying-Hong Feng, Department of Pharmacology, C2021, Uniformed Services University of the Health Sciences, 4301 Jones Bridge Rd., Bethesda, MD 20814. E-mail: yhfeng{at}usuhs.mil
| References |
|---|
|
|
|---|
-arrestin and G protein-mediated ERK activation by the angiotensin II receptor. J Biol Chem 279: 35518-35525.
Ahn S, Wei H, Garrison TR, and Lefkowitz RJ (2004b) Reciprocal regulation of angiotensin receptor-activated extracellular signal-regulated kinases by
-arrestins 1 and 2. J Biol Chem 279: 7807-7811.
Albiston AL, McDowall SG, Matsacos D, Sim P, Clune E, Mustafa T, Lee J, Mendelsohn FA, Simpson RJ, Connolly LM, et al. (2001) Evidence that the angiotensin IV (AT4) receptor is the enzyme insulin-regulated aminopeptidase. J Biol Chem 276: 48623-48626.
Baldwin JM (1993) The probable arrangement of the helices in G protein-coupled receptors. EMBO (Eur Mol Biol Organ) J. 12: 1693-1703.[Medline]
Balmforth AJ, Lee LJ, Warburton P, Donnelly D, and Ball SG (1997) The conformational change responsible for AT1 receptor activation is dependent upon two juxtaposed asparagine residues on transmembrane helices III and VII. J Biol Chem 272: 4245-4251.
Bond RA, Leff P, Johnson TD, Milano CA, Rockman HA, McMinn TR, Apparsundaram S, Hyek MF, Kenakin TP, Allen LF, et al. (1995) Physiological effects of inverse agonists in transgenic mice with myocardial overexpression of the
2-adrenoreceptor. Nature (Lond) 374: 272-276.[CrossRef][Medline]
Boucard AA, Roy M, Beaulieu ME, Lavigne P, Escher E, Guillemette G, and Leduc R (2003) Constitutive activation of the angiotensin II type 1 receptor alters the spatial proximity of transmembrane 7 to the ligand-binding pocket. J Biol Chem 278: 36628-36636.
Ceresa BP and Limbird LE (1994) Mutation of an aspartate residue highly conserved among G-protein-coupled receptors results in nonreciprocal disruption of
2-adrenergic receptor-G-protein interactions. J Biol Chem 269: 29557-29564.
Chen G, Way J, Armour S, Watson C, Queen K, Jayawickreme CK, Chen WJ, and Kenakin T (2000) Use of constitutive G protein-coupled receptor activity for drug discovery. Mol Pharmacol 57: 125-134.
Feng YH and Douglas JG (2000) Angiotensin receptors: an overview, in Angiotensin II Receptor Antagonists (Epstein M and Brunner H eds) pp 29-48, Hanley & Belfus, Philadelphia.
Feng YH, Miura SI, Husain A, and Karnik SS (1998) Mechanism of constitutive activation of the AT1 receptor: Influence of the size of the agonist switch binding residue Asn111. Biochemistry 37: 15791-15798.[CrossRef][Medline]
Gether U and Kobilka BK (1998) G protein-coupled receptors. II. Mechanism of agonist activation. J Biol Chem 273: 17979-17982.
Glossmann H, Baukal A, and Catt KJ (1974) Cation dependence of high-affinity angiotensin II binding to adrenal cortex receptors. Science (Wash DC) 185: 281-283.
Groblewski T, Maigret B, Languier R, Lombard C, Bonnafous JC, and Marie J (1997) Mutation of Asn111 in the third transmembrane domain of the AT1A angiotensin II receptor induces its constitutive activation. J Biol Chem 292: 1822-1826.
Holloway AC, Qian H, Pipolo L, Ziogas J, Miura S, Karnik S, Southwell BR, Lew MJ, and Thomas WG (2002) Side-chain substitutions within angiotensin II reveal different requirements for signaling, internalization and phosphorylation of type 1A angiotensin receptors. Mol Pharmacol 61: 768-777.
Hunyady L, Ji H, Jagadeesh G, Zhang M, Gaborik Z, Mihalik B, and Catt KJ (1998) Dependence of AT1 angiotensin receptor function on adjacent asparagine residues in the seventh transmembrane helix. Mol Pharmacol 54: 427-434.
Hunyady L, Vauquelin G, and Vanderheyden P (2003) Agonist induction and conformational selection during activation of a G-protein-coupled receptor. Trends Pharmacol Sci 24: 81-86.[CrossRef][Medline]
Ji TH, Grossmann M, and Ji I (1998) G Protein-coupled Receptors I. diversity of receptor-ligand interactions. J Biol Chem 273: 17299-17302.
Karnik SS, Gogonea C, Patil S, Saad Y, and Takezako T (2003) Activation of G-protein-coupled receptors: a common molecular mechanism. Trends Endo Metabol 14: 431-437.
Kjelsberg MA, Cotecchia S, Ostrowski J, Caron MG, and Lefkowitz RJ (1992) Constitutive activation of the
1B adrenergic receptor by all amino acid substitutions at a single site. J Biol Chem 267: 1430-1433.
Le MT, Vanderheyden PML, Szaszák M, Hunyady L, and Vauquelin G (2002) Angiotensin IV is a potent agonist for constitutive active human AT1 receptors. J Biol Chem 277: 23107-23110.
Leff P (1995) The two-state model of receptor activation. Trends Pharmacol Sci 16: 89-97.[CrossRef][Medline]
Lefkowitz RJ, Cotecchia S, Samama P, and Costa T (1993) Constitutive activity of receptors coupled to guanine nucleotide regulatory proteins. Trends Pharmacol Sci 14: 303-307.[CrossRef][Medline]
Leurs R, Smit MJ, Alewijnse AE, and Timmerman H (1998) Agonist-independent regulation of constitutively active G-protein-coupled receptors. Trends Biol Sci 23: 418-422.
Marie J, Maigret B, Joseph MP, Larguier R, Nouet S, Lombard C, and Bonnafous JC (1994) Tyr292 in the seventh transmembrane domain of the AT1A angiotensin II receptor is essential for its coupling to phospholipase C. J Biol Chem 269: 20815-20818.
Martin SS, Boucard AA, Clement M, Escher E, Leduc R, and Guillemette G (2005) Analysis of the third transmembrane domain of the human type 1 angiotensin II receptor by cysteine scanning mutagenesis. J Biol Chem 279: 51415-51423.
Miura SI, Feng YH, Husain A, and Karnik SS (1999) Role of aromaticity of agonist switches of angiotensin II in the activation of the AT1 receptor. J Biol Chem 274: 7103-7110.
Miura S, Zhang J, Boros J, and Karnik SS (2003) TM2-TM7 interaction in coupling movement of transmembrane helices to activation of the angiotensin II type-1 receptor. J Biol Chem 278: 3720-3725.
Noda K, Feng YH, Liu X, Saad Y, Husain A, and Karnik SS (1996) The active state of the AT1 angiotensin receptor generated by angiotensin II induction. Biochemistry 35: 16435-16442.[CrossRef][Medline]
Palczewski K, Kumasaka T, Hori T, Behnke CA, Motoshima H, Fox BA, Le Trong I, Teller DC, Okada T, Stenkamp RE, et al. (2000) Crystal structure of rhodopsin: a G protein-coupled receptor. Science (Wash DC) 289: 739-745.
Parnot C, Bardin S, Miserey-Lenker S, Guedin D, Corvol P, and Clauser E (2000) Systematic identification of mutations that constitutively activate the angiotensin II type 1A receptor by screening a randomly mutated cDNA library with an original pharmacological bioassay. Proc Natl Acad Sci USA 97: 7615-7620.
Quitterer U, AbdAlla S, Jarnagin K, and Wuller-Esterl W (1996) Na+ ions binding to the bradykinin B2 receptor suppress agonist-independent receptor activation. Biochemistry 35: 13368-13377.[CrossRef][Medline]
Santos RA, Simoes e Silva AC, Maric C, Silva DM, Machado RP, de Buhr I, Heringer-Walther S, Pinheiro SV, Lopes MT, Bader M, et al. (2003) Angiotensin-(1-7) is an endogenous ligand for the G protein-coupled receptor Mas. Proc Natl Acad Sci USA 100: 8258-8263.
Thomas WG, Qian H, Chang CS, and Karnik SS (2000) Agonist-induced phosphorylation of the angiotensin II (AT1A) receptor requires generation of a conformation that is distinct from the inositol phosphate-signaling state. J Biol Chem 275: 2893-2900.
Tsai BS and Lefkowitz RJ (1978) Agonist-specific effects of monovalent and divalent cations on adenylate cyclase-coupled
-adrenergic receptors in rabbit platelets. Mol Pharmacol 14: 540-549.
Wei H, Ahn S, Shenoy SK, Karnik SS, Hunyady L, Luttrell LM, and Lefkowitz RJ (2003) Independent beta-arrestin 2 and G protein-mediated pathways for angiotensin II activation of extracellular signal-regulated kinases 1 and 2. Proc Natl Acad Sci USA 100: 10782-10787.
Weiss JM, Morgan PH, Lutz MW, and Kenakin TP (1996) The cubic ternary complex receptor-occupancy model. I. Model description. J Theor Biol 178: 151-167.[CrossRef]
This article has been cited by other articles:
![]() |
L. Oliveira, C. M. Costa-Neto, C. R. Nakaie, S. Schreier, S. I. Shimuta, and A. C. M. Paiva The Angiotensin II AT1 Receptor Structure-Activity Correlations in the Light of Rhodopsin Structure Physiol Rev, April 1, 2007; 87(2): 565 - 592. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||